Extract of Centipede Scolopendra
The centipede Scolopendra specimens were purchased from Changsha Jiuzhitang Pharmaceutical Co., Ltd in Hunan province of China. The specimens were identified as authentic by the Department of traditional Chinese medicine of our hospital where a voucher specimen was deposited. The centipede scolopendra was crushed into fine powder. First, 50 g specimens were decocted in 1500 ml alcohol solution (3/2 by v/v; alcohol/water) for 1 h, followed by filtering and collection of the filtrate concentrate. Second, 750 ml alcohol solution (3/2 by v/v; alcohol/water) was added into the filter residue, and the aforementioned procedures were repeated. Third, the two filtrate concentrates were combined, filtered once again and then evaporated to 25 ml. Finally, the stock solution (2 g/ml, 25 ml) was bathed in water at 80 ℃ for 30 min with intermittent sterilization for 3 consecutive days. Subsequently, the samples were centrifuged at 1000 R/min for 10 min and stored at -20 ℃. When in use, the sterile normal saline was added to 400 mg/ml and stored at 4 ℃ and the bacteria were removed by suction. The rotary evaporator was used to concentrate the extract[16].
Cell culture
The GBC-SD cell line was supplied by the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai, China). The cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco BRL, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (HyClone, Logan, UT, USA), 100 U/ml penicillin (Invitrogen, Carlsbad, CA, USA) and 100 U/ml streptomycin (Invitrogen, Carlsbad, CA, USA). The cells were cultured with 5% CO2 at saturated humidity at 37°C.
MTT assay
GBC-SD cells in the logarithmic growth phase were homogeneously transferred to a 96-well plate (2×104 cells/well). After 24 h of culture in complete medium, the cells were treated with centipede scolopendra extract at concentrations of 3.125 mg/ml, 6.250 mg/ml, 12.500 mg/ml, 25.000 mg/ml and 50 mg/ml respectively. After 24 h, 48 h, and 72 h, each hole was added with 10% FBS and 20 ul MTT solution (5 mg/ml) (Sigma-Aldrich, St. Louis, MO, USA). Culturing for 4 h at 37°C, after discarding the supernatant, each hole was added 150 ul DMSO (Sigma-Aldrich, St. Louis, MO, USA). After shaking for 10 min, 100 ul cell suspensions was put into another 96-well plate with 100 ul DMSO solution as a control. The Cell Proliferation Reagent Kit I (MTT; Roche Applied Science) was used at 37˚C for 4 h to determine the cell viability. The absorbance values were determined at 490 nm (A490) using a spectrophotometer (Omega Bio-Tek, Inc.).
The A490 were measured in the experimental group and control group, and the cell inhibition rate was calculated using the formula as follows: the inhibition rate (%) = [1 - (A490 mean value of experimental group/A490 mean value of control group)] × 100%. According to the changes of cell inhibition in the different concentration of centipede scolopendra extract and treatment duration, the optimum concentration and treatment duration of centipede scolopendra extract were confirmed. The experiment was repeated 3 times and the mean value was used to draw the cell growth curve
Colony formation assay
The cells were treated with centipede scolopendra extract as aforementioned. After 48 h of treatment, the cells were harvested and counted after trypsinization. A total of 500 cells/well were placed in a 6-well plate and cultured at 37˚C. The medium was refreshed once every 3 days. After 14 days, the cells were washed with 1×PBS, fixed with 3.7% methanol, and stained with 0.1% crystal violet at 37˚C for 10 min (Sigma-Aldrich, St. Louis, MO, USA). Visible colonies were manually counted using an optical microscope (Olympus Corporation) (each colony contains at least 50 cells).
PUMA-siRNA synthesis
According to the GenBank database, the sequences of primers were designed in Table 1. Three interference siRNAs and one negative control siRNA were synthesized and determined no homology with other nonrelated genes by Genechem Co., Ltd (Table 1). The cells were inoculated in a 6-well plate (5×105 cells/well), and the lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) was used for transfection with the siRNAs at a concentration of 120 nM according to the manufacturer’s instructions. The cells were divided into five groups as follows: PUMA-siRNA-1 group, PUMA-siRNA-2 group, PUMA-siRNA-3 group, PUMA-siRNA-NC group, and normal group. After 24 h, total RNA was extracted and amplified with RT-qPCR, then the more efficient PUMA-siRNA was selected to perform the subsequent experiments.
Table 1
the sequences of PUMA primers, GAPDH primers and three siRNA
Classification | Sequences (5’-3’) |
PUMA | Forward: TGAAGAGCAAATGAGCCAAACG Reverse: CAGAGCACAGGATTCACAGTCT |
GAPDH | Forward: TGACTTCAACAGCGACACCCA Reverse: CACCCTGTTGCTGTAGCCAAA |
PUMA-siRNA-1 | Forward: CGUGUGACCACUGGCAUUCdTdT Reverse: GAAUGCCAGUGGUCACACGdTdT |
PUMA-siRNA-2 | Forward: UCUCAUCAUGGGACUCCUGdTdT Reverse: CAGGAGUCCCAUGAUGAGAdTdT |
PUMA-siRNA-3 | Forward: CAUGGGACUCCUGCCCUUAdTdT Reverse: UAAGGGCAGGAGUCCCAUGdTdT |
PUMA-siRNA-NC | Forward: UUCUCCGAACGUGUCACGUdTdT Reverse: ACGUGACACGUUCGGAGAAdTdT |
The stability of selected PUMA-siRNA in the presence of centipede scolopendra extract was detected. The cells were divided into four groups as follows: PUMA-siRNA group, PUMA-siRNA combined with centipede scolopendra extract group, centipede scolopendra extract group and normal control group. After 24 h, total RNA was extracted and amplified with RT-qPCR.
Flow cytometry
The cells were inoculated in a 6-well plate (1×105 cells/well) and divided into four groups: PUMA-siRNA group, PUMA-siRNA combined with centipede scolopendra extract group, centipede scolopendra extract group, and control group. After treatment with different experimental materials according to the grouping, the cells were harvested, washed twice, resuspended in binding buffer, and stained with the Annexin V and PI solution at room temperature for 30 min. The Annexin V-FITC apoptosis detection kit (Beckman Coulter, Brea, CA, USA) was used to detect the apoptosis of cells by Annexin V-FITC and PI double staining according to the manufacturer’s instructions. The analysis was performed using a BD FACSAria™ II flow cytometer (Becton, Dickinson and Company), and the data were analyzed using CellQuest Pro software (version 5.1; Becton, Dickinson and Company).
RT-qPCR
Following treatment with centipede scolopendra extract and/or PUMA-siRNA, total RNA was exacted from GBC-SD cell lines using Trizol Reagent (Invitrogen, Carlsbad, CA, USA), which were then treated with DNase I (Invitrogen, Carlsbad, CA, USA) for purification according to the manufacturer’s instructions. Reverse transcription was performed at 42˚C for 60 min using miRcute miRNA First-Strand cDNA Synthesis Kit (TaKaRa biotechnology, Dalian, China) according to the manufacturer’s instructions. qPCR was performed using the SYBR® Green PCR detection kit (TaKaRa biotechnology, Dalian, China) in a 7500 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer’s instructions. The sequences of the primers were summarized in Table 1. The 2−ΔΔCt method was used to calculate the relative expression level of target gene[17]. The GAPDH was used as an internal control.
Western blot analysis for the protein expression of p53, PUMA, Bax and Bcl-2
Following treatment with centipede scolopendra extract and/or PUMA-siRNA, total protein was extracted using RIPA lysis buffer (50 mM Tris pH 8.0, 120 mM Nacl, 0.5% sodium deoxycholate, 0.5% NP-40, 0.1% SDS, 1 mM EDTA, 50 mM NaF, 1 mM Na2VO4, 1 mM PMSF, and 2 ug/ml aprotinin) on ice for 30 min. The protein concentration was determined by BCA assay, and 50 µg protein/lane was separated using the 10% sodium dodecyl sulfate-poly-acrylamide gel electrophoresis at 120 V for 60 min, which were then transferred onto polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with the 5% non-fat milk in TBST (10 mM Tri pH 7.4, 150 mM NaCl and 0.1% Tween 20) at room temperature for 60 min and incubated with prepared primary antibodies against PUMA (1:1,000; cat. no. ab33906), p53 (1:500; cat. no. ab131442), Bax (1:1,000; cat. no. ab32503), Bcl-2 (1:2,000; cat. no. ab182858) (all from Abcam) and β-actin (1:1,000; cat. no. A2228; Sigma-Aldrich; Merck KGaA) at 4°C for 12 h with gentle rocking. Next morning, the membranes were washed three times in TBST for 5 min, and then incubated with HRP conjugated goat anti-rabbit IgG (1:2,000; cat. no. sc-2004) or anti-mouse IgG (1:2,000; cat. no. sc-2005) (both from Santa Cruz Biotechnology, Inc.) secondary antibody at 37°C for 60 min. The protein bands were visualized with an enhanced chemiluminescence system (Thermo Fisher Scientific, Inc.) according to the manufacturer’s instructions. The Gel Doc 2000 imaging system (Bio-Rad Laboratories, Inc.) was used for densitometric analysis of the protein bands with ImageJ software (version 1.8.0.112; National Institutes of Health) according to the manufacturer’s instructions. β-actin was used as the internal control.
Statistical analysis
SPSS v17.0 software (SPSS, Inc., Chicago, IL, USA) was used to perform statistical analyses. All data were expressed as the mean ± standard deviation. The differences were analyzed using T test for two groups and One-way Analysis of Variance (ANOVA) with the Bonferroni correction for multiple groups. P < 0.05 was considered statistically significant. All experiments were repeated at least 3 times.