Animal
Adult male Wistar rats were obtained from the Experimental Animal Center of the Soutbern Medical University and housed in a temperature-controlled barrier facility with a 12-h light/dark cycle. All experimental protocols were approved by the Animal Care and Use Committee of Kunming Medical University, and experiments were conducted in adherence with the National Institutes of Health Guidelines for the Use of Laboratory Animals.
Establishment of OSA models and specimen collection
As described previously, the Wistar rats were placed in the hypoxia chamber for 8 h/day for 2 weeks [21]. Briefly, the adult male Wistar rats were randomly divided into the following groups: (1) Control group (NC): rats were placed in the chamber with ad libitum access to food and water, breathing normal air (n=5); (2) 12.5% O2 group (12.5): the oxygen concentration in the hypoxia chamber was maintained at between 12.5–21% with a 2 min cycle time (12.5% O2 for 1 min-21% O2 for 1 min; n=5); (3) 10% O2 group (10): the oxygen concentration in the hypoxia chamber was maintained at between 10–21% with a 2 min cycle time (10% O2 for 1 min-21% O2 for 1 min; n=5); (4) 7.5% O2 group (7.5): the oxygen concentration in the hypoxia chamber was maintained at between 7.5–21% with a 2 min cycle time (7.5% O2 for 1 min-21% O2 for 1 min; n=5); (5) 5% O2 group (5): the oxygen concentration in the hypoxia chamber was maintained at between 5–21% with a 2 min cycle time (5% O2 for 1 min-21% O2 for 1 min; n=5).
To test the functions of ALKBH5 or miR-21-5p, the green fluorescent protein (GFP)‐tagged lentiviral plasmid carrying an shRNA against rat ALKBH5 (si-ALKBH5) and negative control (si-NC) plasmid were packaged by Shanghai GenePharma (Shanghai, China), and the antagomiR-21-5p and antagomiR-21-5p NC were obtained from Shanghai GenePharma. Then, the lentivirus plasmid or antagomiR-21-5p with intratracheal instillation. The rats were randomly divided into 4 groups: (1) Control group (NC; n=5); (2) IR group: 5% O2 group (n=5); (3) IR+si-ALKBH5 group (10 mg/kg lentiviral-si-ALKBH5; n=5); (4) IR+si-ALKBH5+antagomiR-21-5p (10 mg/kg lentiviral-si-ALKBH5 plus 2 mg/kg antagomiR-21-5p; n=5).
On the day following the completion of the intervention, the rats were intraperitoneally anesthetized with 4 ml/kg 10% chloral hydrate (0.4 g/kg). Then, blood samples were collected. Rats were sacrificed and the lung tissues were collected and preserved in a refrigerator at −80°C, fixed in 4% paraformaldehyde at room temperature for 24–48 h or 2.5% glutaraldehyde at 4°C for 2–12 h for subsequent analysis.
Pathological examination
All steps were performed at room temperature. Lung tissues were immediately fixed in 4% paraformaldehyde for 24 h and then dehydrated with an ethanol concentration gradient. The tissue blocks were sectioned at 5 µm thickness, which were dewaxed in xylene (100%; 20 min), rehydrated through decreasing concentrations of ethanol (100% for 10 min; and 95, 90, 80, and 70% for 5 min each) and washed in PBS. Samples were incubated in hematoxylin solution for 8–15 min and wash with water 1–2 min. Samples were then placed in 1% hydrochloric acid in alcohol for differentiation for a 30 sec, followed by washing with water (30–60 min). Samples were immersed in 1% eosin solution for 2–5 min followed by washing with water. Following staining, sections were dehydrated through increasing concentrations of ethanol and xylene (ethanol, 95 and 100% for 5 min; xylene, 100% 5 min). The fibrosis was evaluated by Masson trichrome staining to analyze the changes of collagen using software (Image-pro plus 6.0, Meida Cybernetics LP). The quantitative analysis was called Collagen Volume Fraction (CVF) calculated according to the formula collagen aera/total area×100%. Staining was observed by Nikon Eclipse 80i microscope (Nikon Corporation).
Enzyme-linked immunosorbent assay (ELISA)
The secretory levels of IL-6 (cat. no. ab234570) and TNF-a (cat. no. ab236712) analyzed using their corresponding ELISA kit (Abcam) according to the manufacturer's protocol. The m6A RNA methylation assay kit (cat. no. ab185912; Abcam) was used to measure the m6A content in total RNAs following the manufacture’s protocol. The m6A levels and concentrations of inflammatory cytokines were measured using a microplate spectrophotometer (BioTek Instruments, Inc.) at a wavelength of 450 nm.
Western blot assay
Proteins were extracted from lung tissues or cells using radioimmunoprecipitation assay (Beyotime Institute of Biotechnology), and the concentrations were determined according to the standard protocols of BCA protein assay kit (Beyotime Institute of Biotechnology), respectively. The total protein (30 μg/well) in the supernatant was separated via SDS‑PAGE on 10% gel, and then transferred to PVDF membranes. After blocking with 5% skimmed milk at room temperature for 1 h, the membranes were incubated overnight at 4˚C with rabbit anti‑TLR4 (dilution 1:1000; cat. no., ab13867; Abcam), rabbit anti‑MyD88 (dilution 1:2000; cat. no., ab28763; Abcam), rabbit anti‑p65 (dilution 1:1000; cat. no., ab16502; Abcam), rabbit anti‑ALKBH5 (dilution 1:1000; cat. no., ab244296; Abcam), rabbit anti‑GAPDH (dilution 1:5000; cat. no., ab8245; Abcam). After three washes with TBS with 0.1% Tween‑20, the immunoblots were incubated for 1 h at room temperature with goat alkaline phosphatase‑labeled anti‑rabbit antibody (dilution 1:1,000; cat. no. 14708; Cell Signaling Technology, Inc.). The immunoreactive bands were visualized using an enhanced chemiluminescence reagent (Beyotime Institute of Biotechnology). The blots were semi‑quantified using ImageJ software (version 1.47; National Institutes of Health).
Cell treatment
Rat pulmonary microvascular endothelial cells (PMVEC; cat. no. BNCC338210) was purchased from BeNa Culture Collection; Beijing Beina Chuanglian Biotechnology Research Institute was cultured in DMEM medium (cat. no. 11965084; Thermo Fisher Scientific, Inc.) containing 10% FBS (FBS; Thermo Fisher Scientific, California, USA). PMVEC cells were exposed to IR or normoxic condition in custom-designed, incubation chambers which were attached to an external O2–CO2 hand-driven controller. IR protocol consists of a 17-min hypoxic period (0% O2 and 5% CO2) and 13 min of re-oxygenation period (21% O2 and 5% CO2) per cycle, 2 cycles/hour, 8 cycles/day for 2 days.
Cell transfection
Specific small interfering RNAs (siRNAs) targeting TLR4 (si-TLR4) and ALKBH5 (si-ALKBH5), siRNA-negative control (si-NC), miR-21-5p mimic, NC mimic, miR-21-5p inhibitor, and NC inhibitor were purchased from Shanghai GenePharma Co., Ltd. To overexpress TLR4 or ALKBH5, the sequences of TLR4 or ALKBH5 were inserted into a pcDNA3.1 plasmid to obtain the TLR4 or ALKBH5 overexpression plasmid oe-TLR4 or oe-ALKBH5, and an empty pcDNA3.1 plasmid was used as the negative control (oe-NC). Plasmid DNA, siRNA, miR-mimic or miR-inhibitor was transfected into PMVEC cells (1×105), which were subcultured at a density of 80%, with Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) at 37˚C. After transfection for 48 h, the transfection efficiency was detected via RT-qPCR and western blot, and then subsequent experiments were performed.
Detection of cell apoptosis
Apoptosis was detected using an Annexin V combined fluorescein isothiocyanate/propidine iodide (FITC/PI) cell apoptosis detection kit (Solarbio, Beijing, China). In brief, cells were collected using cold PBS buffer and then cultured with 5 μl Annexin V-FITC reagent and 5 μl PI in the dark for 15 min at room temperature. Subsequently, 400 μl 1× binding buffer was added, and the cells were analyzed using a BD FACSCanto Ⅱ flow cytometer (BD Biosciences) with FlowJo software (version 10; FlowJo LLC).
RNA extraction and reverse transcription‑quantitative PCR (RT-qPCR)
Total RNA was extracted from lung tissues or PMVEC cells using TRIzol reagent (Solarbio) according to the manufacturer's protocol. First‑strand cDNA was synthesized from the total RNA according to the instructions of the Universal RT-PCR kit (Solarbio), and RT‑qPCR was subsequently performed using the 2× SYBR Green PCR Mastermix (Solarbio), according to the manufacturer's protocols. The following primer sequences were used for RT‑qPCR: TLR4 forward, 5'‑TGGCATCATCTTCATTGTCC‑3' and reverse, 5'‑CAGAGCATTGTCCTCCCACT‑3'; ALKBH5 forward, 5'‑ACCCGCAAGGTGAAGATGAG‑3' and reverse, 5'‑GCCTTAATGGGCAACAAAGCA‑3'; miR‑448 forward, 5'‑GCCGAGTTGCATATGTAGGA‑3' and reverse, 5'‑ATGCATGCCACGGGCATATACACT‑3'; miR-21-5p forward, 5'‑GTCAATAGCTTATCAGACTGA‑3' and reverse, 5'‑GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCA‑3'; pre-miR-21-5p forward, 5'‑TGTCGGGTAGCTTATCAGAC‑3' and reverse, 5'‑TTCAGACAGCCCATCGACTG‑3'; miR-31-3p forward, 5'‑ACACTCCAGCTGGGTGCTATGCCAACAT‑3' and reverse, 5'‑TGGTGTCGTGGAGTCG‑3'; U6 forward, 5'‑CGCTTCGGCAGCACATATACTAAAATTGGAAC‑3' and reverse, 5'‑GCTTCACGAATTTGCGTGTCATCCTTGC‑3'; and GAPDH forward, 5'‑AGAAGGCTGGGGCTCATTTG‑3' and reverse, 5'‑AGGGGCCATCCACAGTCTTC‑3'. The RT‑qPCR experiments were performed on an Applied Biosystems 7900HT Fast Real‑time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The following thermocycling conditions were used for RT‑qPCR: Initial denaturation at 95˚C for 10 min; followed by 40 cycles of denaturation at 95˚C for 15 sec, annealing at 60˚C for 30 sec and elongation at 72˚C for 30 sec. The relative expression levels were calculated using the 2‑ΔΔCq method [22]. GAPDH and U6 were used as the internal reference of mRNA and miRNA, respectively.
Methylated m6A RNA immunoprecipitation assay (Me-RIP)
Me-RIP was performed according to the reported protocol using an anti-m6A antibody (dilution 1:500; cat. no., ab151230; Abcam) [23]. RT-qPCR analysis of the methylated RNA was performed to detect methylated pre-miR-21 levels. Me-RIP assays were replicated three times.
Bioinformatics and luciferase reporter assays
StarBase (http://starbase.sysu.edu.cn/) online software was used to predict the binding sites of miRNAs to target mRNAs. The TLR4-wild-type (WT)/mutant (MUT) reporter plasmids were provided by Shanghai GenePharma Co., Ltd. PMVEC cells (1×105/well) were co-transfected with TLR4-WT/MUT plasmid and miR-21-5p mimic or NC mimic using Lipofectamine® 2000 reagent at 37˚C. At 48 h post‑transfection, luciferase activity was determined using the dual-luciferase reporter assay system (Promega Corporation). Firefly luciferase activities were normalized to Renilla luciferase activities.
Statistical analysis
All the experiments were repeated three times. GraphPad Prism 8 (GraphPad Software, Inc.) was used for statistical analysis, and the data are presented as the mean ± standard deviation. Data between two groups were analyzed using an unpaired Student's t-test, and data among multiple groups were analyzed by one-way analysis of variance followed by a Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.