Animals
Male C57/BL6 mice aged 8 weeks were procured from Vital River Experimental Animal Technology Co., Ltd. (Beijing, China). All animal experiments were approved by the Animal Ethics Committee of the Academy of Military Medical Sciences (Ethical Approval Number: IACUC-DWZX-2020-719). All surgical and irradiation procedures were performed under anesthesia, and animal suffering was minimized as much as possible.
Irradiation
A Cobalt-60 radiation facility at the Institute of Radiation Medicine, the Academy of Military Medical Sciences (Beijing, China), was used for irradiation. 6 Gy γ-rays at dose rates of 0.5–1 Gy/min were applied to cells or mice. Except the hind legs and lower abdomens, the whole mouse body was obstructed and protected from γ-rays using lead blocks.
Isolation, culture and identification of CBSCs
CBSCs were isolated as previously described [19]. Briefly, the femurs were extracted after mice execution. Sterile scissors were used to remove the epiphyses just below the end of the marrow cavity, followed by thorough washing of the bone cavities using alpha minimal essential medium (α-MEM) until the bones appeared pale. The compact bones were excised into chips of approximately 3 mm3, and were transferred into Eppendorf tubes containing 1 ml of α-MEM and 1 mg/ml of collagenase II at 37 °C for 1 h, followed by incubation at 37 °C in a 5% CO2 incubator. Peridinin chlorophyll protein complex (PerCP)-conjugated anti-mouse CD45 antibodies and Phycoerythrin (PE)-conjugated anti-mouse spinocerebellar ataxia type 1 protein (Sca-1), CD140a, CD105, CD80, CD44, CD31, and CD11b antibodies (eBioscience, Cambridge, UK) were used to stain CBSCs for 30 min in the dark according to the manufacturer’s instructions. Then flow cytometry analysis was performed using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA) and data were analyzed using the FlowJo V10 software (BD Biosciences). For melatonin treatment, various concentrations of melatonin treated CBSCs from 1 hour after irradiation for 24 h.
Analysis of colony-forming unit fibroblast (CFU-F)
CBSCs were seeded into 6-well plates at a density of 200 cells/well and cultured for 12 days. When visible colonies were formed, the colonies were fixed with 20% methanol, stained with 0.1% crystal violet, and photographed. Finally, positive colony formation (more than 50 cells/colony) was determined by counting under a microscope.
Osteogenesis and adipogenesis assay
The complete media for differentiation were purchased from Cyagen Biosciences (Santa Clara, CA, USA). Total RNA was extracted for quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) after osteogenic and adipogenic differentiation. Alkaline phosphatase staining was performed according to the manufacture’s instructions (Beyotime) after two weeks of osteogenic differentiation. Alizarin red S staining was performed to assess calcium deposition after three weeks of osteogenic differentiation. CBSCs were fixed and lipid droplets were visualized using filtered Oil red O after two weeks of adipogenic differentiation.
Cell apoptosis analysis
An Annexin V-Allophycocyanin (APC)/7-Aminoactinomycin D (7-AAD) apoptosis detection kit (Keygen, Jiangsu, China) was used to determine apoptosis of CBSCs. Briefly, 2 × 105 cells in suspension were centrifuged at 1000×g for 5 min and the supernatant was discarded. Thereafter, the cells were re-suspended in 500 µl of binding buffer. Then, 5 µl of APC and 5 µl of 7-AAD were added to the suspension and incubated for 15 min at room temperature in the dark. Cell apoptosis was determined by flow cytometry for 2 × 104 events at a flow rate not exceeding 500 cells per second and the data were analyzed using the FlowJo V10 software.
Determination of ROS, MDA, SOD Levels and GSH/GSSG ratio
Intracellular reactive oxygen species (ROS) levels were investigated using a ROS Assay Kit (Beyotime). Briefly, CBSCs were seeded at 105 cells in 25 mm3 culture flasks. Then the medium was replaced with serum-free medium containing a Dichlorofluorescein-diacetate (DCFH-DA) probe at a final concentration of 10 µmol/L and placed in the dark for 30 min. The cells were then harvested and fluorescence detection was performed using flow cytometry at an emission wavelength of 525 nm and an excitation wavelength of 488 nm. The measurement of intracellular malondialdehyde (MDA), superoxide dismutase (SOD) levels and glutathione/oxidized glutathione (GSH/GSSG) ratio was performed according to the manufacture’s instructions using a MDA assay kit (Ray Biotech), a SOD assay kit (Beyotime) and a GSH/GSSG assay kit (Beyotime).
qRT-PCR
The TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to isolate total RNA from the cells. A reverse transcription kit (Yishan, Shanghai, China) was then used to reverse transcribe the RNA to cDNA. The quantitative real-time PCR (qPCR) reaction was performed according to the reagent instructions of the UltraSYBR Mixture (CWBIO, Beijing, China), using the cDNA as the template and the following reaction program: 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 sec, 60 °C for 30 sec and 72 °C for 30 sec. Sangon Biotech (Shanghai, China) synthesized all the primers. The primers used in this study are listed as follows (5’-3’): Runx2, sense, GACTGTGGTTACCGTCATGGC and anti-sense, ACTTGGTTTTTCATAACAGCGGA; Opn, sense, ATCTCACCATTCGGATGAGTCT and antisense, TGTAGGGACGATTGGAGTGAAA; Pparg, sense, GGAAGACCACTCGCATTCCTT and antisense, GTAATCAGCAACCATTGGGTCA; Cebpa, sense, GCGGGAACGCAACAACATC and antisense, GTCA-CTGGTCAACTCCAGCAC. Relative gene expression was quantified using the 2−ΔΔCt method [20].
Immunofluorescence
Cells were seeded at a density of 2 × 104/well into 12-well plates plated with cell-climbing slices. Paraformaldehyde was then used to fix the cells and 0.5% Triton X-100 was used to permeabilize them. Goat serum was then used to block non-specific binding to the cells before incubation with antibodies against gamma H2A histone family, member X (γH2AX; 1:200; CST, Danvers, MA, USA) overnight at 4 °C. The cells were then incubated with secondary antibodies conjugated to a fluorescent dye. Nuclear counterstaining was achieved using 4’,6-diamidino-2-phenylindole (DAPI) at room temperature for 15 min. The coverslips with the cells were inverted on glass slides and fluorescence was assessed under a laser confocal microscope.
Western blotting analysis
Radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime, Shanghai, China) with 1 mM phenylmethanesulfonylfluoride (PMSF) was used to lyse the cells. Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific, Wilmington, DE, USA) were used to extract the nucleoproteins. SDS-PAGE (7.5–10% polyacrylamide gels) was used to separate the proteins, which were then transferred to polyvinylidene fluoride (PVDF) membranes (Thermo Scientific). Next, the membranes were blocked with 5% skim milk for 1 h and then incubated with the primary antibodies (1:1000) (CST) at 4°C overnight, followed by incubation with secondary antibodies (1:2000) (CST) at room temperature for 2 h. The immunoreactive protein bands were visualized using an enhanced chemiluminescence (ECL) kit (Thermo Scientific). A Luminescent Image Analyzer LAS4000 (Fuji Film, Tokyo, Japan) and ImageJ software (NIH, Bethesda, MD, USA) were used to detect and quantify the protein band signals. U0126 ERK pathway inhibitor was from Sigma-Aldrich (Danvers, MA, USA). ML385 NRF2 pathway inhibitor was purchased from MedChemExpress (Shanghai, China).
Femoral bone defect models
At 1 hour after irradiation, the mice were subjected to bone defect surgery. A femoral defect (1.5 mm diameter and 1 mm depth) was generated at the distal third of the femur as previously described [21]. Surgically treated, nonirradiated mice were used as blank controls. Melatonin was first diluted in absolute ethanol and then mixed and diluted with Matrigel at 4 °C to achieve a concentration of 100 µM. Matrigel presents as liquid form at 4 °C and in a semi-solid form at 37 °C. A 10 µL aliquot of Matrigel mixed with melatonin was injected into the postradiation femoral defect. The same volume of Matrigel without melatonin was used as a control. At 4 weeks after surgery, the mice were sacrificed, and micro-CT analysis and pathological evaluation of the harvested femurs were performed.
Micro-CT scan
The femur samples were fixed in formaldehyde for 24 h, and then placed in a 50 mm diameter tube that was oriented perpendicular to the scanning axis. Bone samples were then scanned using a Quantum GX micro-CT imaging system (PerkinElmer, Waltham, MA, USA) using the following settings: 70 kV, 100 µA and 14 min exposure time. A selected area (27 mm3) of the three-dimensional reconstruction was centered at bone drilling site, followed by determination of the bone mineral density (BMD) and trabecular bone volume per tissue volume (BV/TV).
Hematoxylin-eosin staining, Masson staining and immunohistochemistry
Femurs were obtained, fixed in formaldehyde for 24 h, decalcified for 3 weeks, and embedded in paraffin. Femur sections were deparaffinized in xylene, dehydrated in ethanol and rinsed with tap water. Then stained those sections with haematoxilin and eosin solution each for 5 min (HE staining) or Lichun red magenta, phosphomolybdic acid, aniline blue solution each for 5 min (Masson staining). The sections for immunohistochemistry (IHC) analysis were subjected to the same dehydration protocol before antigen retrieval. TNF-α and IL-6 primary antibodies (1:100) were added to the sections, which were incubated overnight at 4 °C. The next day, the sections were incubated with secondary antibody labeled with horseradish peroxidase at 37 °C for 50 min. Diaminobenzidine was added to sections for approximately 10 min for color development. The sections were then counterstained with hematoxylin, dehydrated, incubated with xylene to make them transparent. All sections were sealed with neutral balsam followed by observation under an optical microscope.
Statistical analysis
The mean ± the standard deviation (SD) from at least three independent experiments was used to represent all the quantitative variables in the present study. GraphPad Prism 6.02 (GraphPad software Inc., San Diego, CA, USA) was used to carry out the statistical analyses. One-way analysis of variance (ANOVA) was used to compare the data from multiple groups. Statistical significance was accepted at a P value less than 0.05.