Mouse breeding
The Advillin-Cre (Avil-Cre) mouse strain was kindly provided by Xingzhong Dong (Department of Neuroscience, The Johns Hopkins University, Baltimore, MD, USA). The TrkAfl/fl mice were obtained from David D. Ginty (Department of Neurobiology, Harvard Medical School, Boston, MD, USA). The LysM-Cre mice and iDTRfl/fl mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). The COX2fl/fl mice were provided by Harvey Herschman (Department of Biological Chemistry, University of California, Los Angeles, Los Angeles, CA, USA). The EP4fl/ fl mice were obtained from Brian L. Kelsall (Laboratory of Molecular Immunology, National Institutes of Health, Bethesda, MD, USA). Heterozygous male Avil-Cre mice were crossed with a TrkAfl/fl or EP4fl/fl mouse. The offspring were intercrossed to generate the following genotypes: wild type (referred to as WT in the text), Avil-Cre (Cre recombinase expressed driven by advillin promoter), TrkAfl/fl (mice homozygous for TrkA flox allele, referred to as TrkAwt in the text), EP4fl/fl (mice homozygous for EP4 flox allele, referred to as EP4wt in the text), Avil-Cre::TrkAfl/fl (conditional deletion of TrkA receptor in Advillin lineage cells, referred to as TrkAAvil−/− in the text), Avil-Cre::EP4fl/fl (conditional deletion of EP4 receptor in Advillin lineage cells, referred to as EP4Avil−/− in the text). Heterozygous male LysM-Cre mice were crossed with an iDTRfl/fl mouse or a COX2fl/fl mouse. The offspring were intercrossed to generate the following genotypes: WT, LysM-Cre, iDTRfl/fl, COX2fl/fl mice (mice homozygous for COX2 flox allele, referred to as COX2wt in the text), LysM-Cre::iDTRfl/- (referred to as iDTRLysM+/− in the text), LysM-Cre::COX2fl/fl (conditional deletion of COX2 in monocyte-macrophage lineage, referred to as COX2LysM−/− in the text).
The genotypes of the mice were determined by polymerase chain reaction (PCR) analyses of the genomic DNA, which was extracted from mouse tails. The primers used for genotyping were Avil-Cre: Forward: CCCTGTTCACTGTGAGTAGG, Reverse: GCGATCCCTG AACATGTCCATC; LysM-Cre: Forward: CCCAGAAATGCCAGATTACG, Reverse: CTTGGGCTG CCAGAATTTCTC; TrkA loxP allele: Forward: AACAGTTTTGAGCATTTTCTATTGTTT, Reverse: CAAAGAAAACAGAAGAAAAAT AATAC; iDTR loxP allele: Forward: GCGAAGAGTTTGTCCTCAACC, Reverse: AAAGTCGCTCT GAGTTGTTAT; COX2 loxP allele: Forward: AATTACTGCTGAAGCCCACC, Reverse: GAATCTC CTAGAACTGACTGG; EP4 loxP allele: Forward: TCTGTGAAGCGAGTCCTTAGGCT, Reverse: CG CACTCTCTCTCTCCCAAGGAA. All animals were maintained at the animal facility of The Johns Hopkins University School of Medicine. All animal experimental protocols and relevant ethical regulations were followed, and the study was approved by the Animal Care and Use Committee of The Johns Hopkins University, Baltimore, MD, USA.
In vivo treatment
Twenty percent alginate gel (Alg) was prepared by mixing sodium alginate powder (Sigma-Aldrich, St. Louis, MO, USA) in deionized water, while 10% magnesium chloride (MgCl2, Sigma-Aldrich), 10% zinc chloride (ZnCl2, Sigma-Aldrich), and 10% copper chloride (CuCl2, Sigma-Aldrich) were used for the preparation of magnesium cross-linked alginate (Mg-Alg), zinc cross-linked alginate (Zn-Alg), and copper cross-linked alginate (Cu-Alg). Twelve-week-old male mice were anesthetized by intraperitoneal injection with ketamine (75 mg/kg) and xylazine (10 mg/kg). A longitudinal incision was made at the left knee and the patella was dislocated to expose the femoral condyle. Using a 20-gauge needle, we created a tunnel with a diameter of 1 mm from the patellofemoral groove of the distal femur along the axis of the femoral shaft. After thorough irrigation with saline, either pure alginate or divalent cation–releasing alginate was injected into the femoral canal. The wound was sutured, and the mice were housed in a specific-pathogen-free facility after the surgery. A monocyte-macrophage lineage depletion mouse model was induced by intraperitoneal injection of diphtheria toxin (DTX, Sigma-Aldrich) in iDTRLysM+/− mice every other day during the week before and the week after the surgery. A PGE2 degradation enzyme inhibitor, SW033291 (Selleck Chemicals, Houston, TX, USA), was administered by intraperitoneal injection at 10 mg/kg every day for 1 week after the surgery. A low-dose β-adrenergic receptor blocker, propranolol (PROP, Sigma-Aldrich, 1576005), was administered by intraperitoneal injection at 0.5 mg/kg every day for 1 week after the surgery.
µCT analysis
At designated time points, the femurs were harvested from the mice and fixed overnight using 4% paraformaldehyde. Analysis was performed using a high-resolution µCT scanner (SkyScan 1275, Bruker, Kontich, Belgium). The voltage of the scanning procedure was 65 kv with a 153-μA current. The resolution was set to 8.7 μm per pixel. Two phantom-contained rods with a standard density of 0.25 and 0.75 g/cm3 were scanned with each sample for calibration. Data reconstruction was completed using NRecon software (v1.6, SkyScan), data analysis was accomplished using CTAn software (v1.9, SkyScan), and 3D model visualization was performed using CTvox software (v3.2, SkyScan). Bone volume fraction (BV/TV), bone mineral density (BMD of TV), trabecular number (Tb. N), trabecular thickness (Tb. Th), cortical thickness (Ct. Th), cortical area (Ct. Ar), bone perimeter (B. Pm), and ρ-moment of inertia (ρMOI) were measured via µCT data.
Immunofluorescence and histomorphometric analysis
At designated time points, mice femurs were fixed with 4% paraformaldehyde overnight and decalcified with 10% ethylenediaminetetraacetic acid (pH = 7.4) for 21 days. For immunostaining, the samples were dehydrated in 20% sucrose solution with 2% polyvinylpyrrolidone (PVP, Sigma-Aldrich) for 24 hours and embedded in 8% gelatin (Sigma-Aldrich) supplemented with 20% sucrose and 2% PVP. Forty-μm-thick coronal-oriented sections of the femurs were obtained using a cryostat microtome. For histomorphometry, the samples were dehydrated in ethanol, embedded in paraffin, and prepared into 5-µm-thick coronal-oriented sections using a rotary microtome. The brain and dorsal root ganglia (DRG) tissues harvested from the mice were fixed with 4% paraformaldehyde, dehydrated with 30% sucrose, and embedded in an optimal cutting temperature compound (OCT, Sakura Finetek, Torrance, CA, USA). Ten-μm-thick coronal-oriented sections of the brain and DRG were obtained using a cryostat microtome.
Immunostaining was performed using a standard protocol. Briefly, the sections of the brain and DRG were incubated with primary antibodies to mouse OCN (Abcam, Cambridge, UK, ab93876, 1:200), CD68 (Abcam, ab31630, 1:400), CGRP (Abcam, ab81887, 1:300), PGP9.5 (Abcam, ab108986, 1:300), COX2 (Abcam, ab15191, 1:200), CREB (Abcam, 178322, 1:200), p-CREB (Abcam, ab32096, 1:200), and TH (MilliporeSigma, Burlington, MA, USA, AB152, 1:100) overnight at 4°C. Alexa-Fluor 488-conjugated and Alexa-Fluor 647-conjugated secondary antibodies (Thermo Fisher Scientific, Waltham, MA, USA) were used for immunofluorescent staining, while the nuclei were counterstained with Hoechst 33324 (Thermo Fisher Scientific). Immunofluorescent images were captured using a LSM 780 confocal microscope (Zeiss, Oberkochen, Germany). Hematoxylin and eosin (H&E) staining, Safranin O and fast green staining, and TRAP staining (Sigma-Aldrich) were performed in selected slides from each sample according to the manufacturer’s instructions. Images were captured using a polarized light microscope (Nikon Eclipse VL100POL, Tokyo, Japan), and quantitative histomorphometric analysis was performed using Image J software (v.1.5, National Institutes of Health, Bethesda, MD, USA).
Cell culture
Primary BMM and DRG neurons from 4-week-old mice were isolated. After the mice were euthanized, both femurs were dissected to remove soft tissue. The femurs were then crushed into pieces and digested with α-MEM (Minimum Essential Medium Eagle α Modification) containing 3 mg/mL collagenase I (Worthington Biochemical Corp, Lakewood, NJ, USA), 4 mg/mL dispase (Sigma-Aldrich), and 1 U/mL deoxyribonuclease-I (Invitrogen, Thermo Fisher Scientific). The single-cell suspension was achieved by passing the solution through a cell strainer to remove tissue fragments. After incubation in a humidified incubator with 5% CO2 at 37°C, the non-adherent cells were harvested and cultured in α-MEM supplemented with 20 ng/mL macrophage colony-stimulating factor (M-CSF, R&D Systems, Minneapolis, MN, USA) for 7 days. For the primary culture of DRG neurons, DRGs from the L2–L5 spinal levels were isolated in cold DMEM/F12 (Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12) medium (Invitrogen, Thermo Fisher Scientific) and then digested with 1mg/mL collagenase type A (Roche, Basel, Switzerland) at 37°C. After trituration and centrifugation, cells were resuspended and seeded on glass coverslips coated with ploy-D-lysine and laminin. The culture medium was replaced 6 hours after seeding, and the adherent cells were further cultured at 37°C with 5% CO2 for 3 days before use.
ELISA
Whole blood samples were collected by cardiac puncture immediately after the mice were euthanized. Serum was collected by centrifuging at 200 rpm for 15 minutes and then stored at −80°C before analysis. The total bone protein was harvested from the femurs grafted with pure alginate or Mg-Alg. The mid-shaft of the femur, approximately 1 cm long, was ground into mud using a ceramic mortar and pestle under cooling. The mud of the bone tissue was then homogenized in pre-cooled radioimmunoprecipitation assay (RIPA) lysis and extraction buffer (Thermo Fisher Scientific) for 1 hour. The buffer solution was centrifuged at 15,000 rpm for 20 minutes at 4°C. The supernatant was collected for protein concentration quantification with the BCA Protein Assay Kit (Thermo Fisher Scientific). An equal amount of protein from each sample was subjected to quantitative analysis using a specific ELISA kit per the manufacturer’s instruction. The PGE2 concentrations in the serum and bone marrow were determined by the PGE2 ELISA kit (Cayman Chemical, Ann Arbor, MI, USA). The OCN level was determined by an OCN ELISA kit (Biomedical Technologies Inc, Tewksbury, MA, USA). The serum and urine epinephrine levels were determined by an epinephrine ELISA kit (ALPCO, Salem, NH, USA).
Quantitative real-time polymerase chain reaction (qPCR)
The total RNA of the cells was extracted and purified using the RNeasy Plus kit (Qiagen, Germantown, MD, USA) per the manufacturer’s instructions. For the reverse transcription, complementary DNA was synthesized using the SuperScript First-Strand Synthesis System (Invitrogen, Thermo Fisher Scientific). The primers used in the RT–qPCR assay were synthesized by Life Technologies (Thermo Fisher Scientific) based on sequences retrieved from Primer Bank (http://pga.mgh.harvard.edu/primerbank, Supplementary Table 1). SYBR Green-Master Mix (Qiagen, Germantown, MD, USA) was used for the amplification and detection of complementary DNA on a C1000 Thermal Cycler (Bio-Rad Laboratories, Hercules, CA). The mean cycle threshold (Ct) value of each target gene was normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The results were shown as a fold change using the ∆∆Ct method.
Western blot
The total protein from animal tissues or cell cultures was lysed using RIPA lysis and extraction buffer (Thermo Fisher Scientific) supplemented with a protease inhibitor cocktail (Thermo Fisher Scientific). After centrifugation at 15,000 × g for 10 minutes at 4°C, the supernatants were collected to measure the protein concentration with the BCA Protein Assay Kit (Thermo Fisher Scientific). A total of 30 µg of protein was subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis and then blotted on the nitrocellulose membranes (Bio-Rad Laboratories). The membrane was blocked in 5% w/v bovine serum albumin (BSA, Sigma-Aldrich) and incubated with blocking buffer-diluted primary antibodies overnight at 4°C. The primary antibodies used were CREB (Abcam, 178322), p-CREB (Abcam, ab32096), HTR2C (ab197776), COX2 (Abcam, ab15191), p-IκBα (CST, 2859), IκBα (CST, 4814), p-NF-κB p65 (CST, 3033), NF-κB p65 (CST, 8242), and β-actin (CST, 3700). The proteins were visualized by an enhanced chemiluminescence kit (Amersham Bioscience, Little Chalfont, UK) and exposed under a ChemiDoc XRS System (Bio-Rad Laboratories).
Behavioral analysis
The spontaneous activity of mice after surgery was assessed using spontaneous activity wheels (BIO-ACTIVW-M, Bioseb, Boulogne, France). Mice were housed in polycarbonate cages with free access to stainless steel activity wheels (diameter 23 cm; width 5 cm), which were connected to an analyzer that automatically recorded the distance traveled, mean speed, maximum speed, and total active time. The mice had ad libitum access to food and water during the test. They were allowed to acclimatize to the environment for at least 24 hours before data were recorded.
Chromatin immunoprecipitation (ChIP) assay
After the stimulation, the ChIP assay was performed using an Agarose ChIP Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. In brief, the chromatin was cross-linked by 1% formaldehyde and digested by micrococcal nuclease. The lysate was incubated with rabbit anti-NF-κB p65 at 4°C overnight followed by incubation with ChIP Grade Protein A/G Plus Agarose. The purified DNA was analyzed by PCR assay using primers targeting mouse COX2 promoters: sense 5’-CCCGGAGGGTAGTTCCATGAAAGACTTCAAC-3’ and antisense 5’-GGTGGAGCTGGCAGGATGCAGTCCTG-3’. The primers targeting the GAPDH promoter served as a positive control. PCR products obtained after 40 cycles were separated on 2% agarose gels.
Statistical analysis
All data analyses were performed and illustrated using Prism software (v. 7, GraphPad Software, San Diego, CA, USA). Data are presented as means ± standard deviations (SD). For comparisons between 2 groups, 2-tailed Student’s T-tests were used. For comparisons among multiple groups, 1-way or 2-way analysis of variance (ANOVA) was used, followed by Tukey’s post hoc test. Significant differences among groups were defined and noted as *P < 0.05 or **P < 0.01. Sample size was based on preliminary data, as well as on observed effect sizes.