Molecular analysis
Multiple alignments and the identity analysis of the NA amino acid sequences from various influenza viruses were carried out using the GeneDoc program, version 2.6.002. The amino acid sequences of the NA proteins were obtained from GenBank and the Global Initiative on Sharing All Influenza Data (GISAID) database. Nucleotide sequences used in this study are available under the following accession numbers: ABP52008, AFH57913, AHZ39785, ALH38476, AQY18948, CY187620, FJ577544, HM138502, L37330, MN716456, MT467157, QHQ82622. Three-dimensional model of the NA insertion (AA 123-331) was created using Cn3D software.
Obtaining a chimeric protein from E. faecium L3 d2 gene and a fragment of the NA gene
DNA fragments corresponding to the NA gene coding 209 AA (123-331) was embedded into recombinant DNA plasmid pentF-pspf, obtained by inserting a total DNA fragment consisting of two separate fragments of the probiotic E. faecium L3 gene and a chimeric pneumococcal protein (PSPF) gene fragment, described in [20]. The oligonucleotide primers used for the reaction are listed in Table 1.
Table 1. Oligonucleotide primers.
Primers
|
Direction
|
Nucleotide sequence from 5' to 3'
|
EV
|
forward
|
GCATATGGCGATCCTGGCAAGTGTTAT1
|
FV
|
reverse
|
GGAATTCCTAGAGCTGTCGTCGTTCC
|
A1
|
forward
|
GCTCTAGAGCCGATGAGAGCAGCTGGTATTG
|
D1
|
reverse
|
CAACAGGATCCAAAGCATCGTTGG
|
B1
|
forward
|
TGAGTGAACCACAGCCAGAA
|
Seq F
|
forward
|
GGACACCACAACCATCGAAG
|
Seq R
|
reverse
|
AGCTGGACCATGCTACACA
|
1 Underlined nucleotides indicate restriction sites.
We removed the PSPF gene insert from the pentF-pspf plasmid DNA and replace it with the NA gene insert. For this plasmid DNA pentF-pspf was digested with NdEI and EcoRI enzymes in the restriction sites which surround the PSPF gene sequence. The same restriction sites were inserted into primers EV and FV to amplify the NA gene fragment (Table 1). The resulting fragment after hydrolysis was used for further cloning (Figure 1, A). RNA of the A/17/duck/Potsdam/86/92 (H5N2) influenza virus was isolated from the virus-containing allantoic fluid using the Viral RNA Mini Kit (Qiagen, Hilden, Germany). DNA on the viral RNA template was obtained using a single-step reverse transcriptase polymerase chain reaction (PCR) with primers EV and FV using the OneStep RT-PCR Kit (Qiagen, Hilden, Germany). The resulting PCR product was excised from an agarose gel and digested with NdEI and EcoRI. Cloning of the restriction fragment after amplification of the DNA fragment encoding the NA fragment was carried out using the upper fragment after hydrolysis of the pentF-pspf plasmid (Figure 1, A).
Restriction products were separated by electrophoresis in 1% agarose gel. Restricted DNA was isolated from agarose using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), ligated and transformed into a heterologous E. coli DH5α system. The selection medium contained 500 μg/ml erythromycin. DNA was isolated from the obtained a number of clones after transformation, which were tested in the PCR reaction with primers EV and FV and with specially designed primers SeqF and SeqR where 8 transformants were positive. From two of transformants, plasmids were isolated that contained the expected insert. The presence of the insert was confirmed by hydrolysis of the plasmid with NdEI and EcoRI. Thus, as a result of cloning, the pentF-na plasmid with the expected insert and erythromycin resistance gene was obtained. For further incertion, we chose a plasmid isolated from clone 1 and designated as pentF-na. Figure 1, B presents integration scheme of the plasmid pT7ermB with the ent-na into the chromosome of the strain E. faecium L3.
Electroporation of Enterococci was performed as previously described [20]. As a result, 13 transformants were obtained from which 12 transformants were positive in PCR test with EV and FV primers (Figure 2).
One of the transformants was selected and designated as the NA-positive clone. Amplification of DNA isolated from this clone was carried out using B1 and FV primers and B1 and Seq R primers for sequencing. Sequencing of DNA isolated from the NA+ clone was carried out with primers corresponding to the NA gene sequence (primer Seq R) and the Enterococcus chromosomal DNA sequence (primer B1) to confirm the integration of pentF-na plasmid DNA into Enterococcus chromosomal DNA (Supplementary data 1).
This clone of Enterococci expressing the NA protein was selected as a vaccine candidate for further research.
Real-time reverse transcriptase PCR (rRT-PCR)
To confirm the expression of the inserted NA gene in bacterial DNA, we studied the expression of mRNA using real-time reverse transcriptase PCR (rRT-PCR) with NA-specific primers. Bacteria were grown in THB (Todd Hewitt Broth (Condalab, Madrid, Spain)) medium at 37°C for 18 hours. E. faecium L3-NA was cultivated with 5 μg/ml of erythromycin. Bacteria were washed three times in PBS by centrifugation at 3500 rpm for 20 minutes and suspended in PBS. 10x concentrate was used for m RNA analysis. Isolation of total RNA was carried out using the GeneJET RNA Purification Kit (Thermo Scientific, Waltham, United States). The isolated RNA was treated with 1U/µl DNase (Invitrogen, Waltham, United States) after which one-step rRT-PCR was performed in on a SFX96 thermocycler (Biorad, Hercules, United States) using HS-qPCR SYBR Blue master-mix (Biolabmix, Novosibirsk, Russia). As a normalizing gene we used D-alanine-D-alanine ligase gene of E. faecium L3 with following primers: F-ttgaggcagaccagattgacg, R-tatgacagcgactccgattcc.
Study of expression of NA protein on the surface of E. Faecium L3 using ELISA
The modified and unmodified 24-hours Enterococcus culture was sorbed on 96-well ELISA plates (Thermo Scientific, Waltham, United States)) for a day. For this, the bacterial suspension was grown as mentioned above and washed 3 times in PBS, after which the protein concentration was determined by the Lowry method [21] and diluted to a final protein concentration of 2 μg /ml. After that, serial dilutions of human blood sera with known titers of antibodies to NA were introduced into the wells of the plate. Thereafter, ELISA was performed as described earlier [19] using goat antibodies to human IgG (Sigma-Aldrich, St. Louis, United States) as a conjugate. The presence of NA-inhibiting (NI) antibodies in human sera ≥1:160 was confirmed in the enzyme-linked lectin assay (ELLA) test as previously describеd [22]. The titer of serum NI antibodies was determined as the reciprocal dilution of the sample with 50% inhibition of NA activity.
Immunoelectron microscopy to study the structure of E. Faecium L3 pili with expression of viral proteins.
Bacteria were grown in LB (Lysogeny broth, VWR Life Science Products Amresco, Solon, United States)) medium at 37°C for 18 hours. E. faecium L3-NA was cultivated with 5 μg/ml of erythromycin. Bacteria were washed three times in PBS by centrifugation at 3500 rpm for 20 minutes and suspended in 0,1 M NaCl. 10x concentrate was used for microscopy. Immunogold labeling was performed using human polyclonal antibodies specific for NA as primary antibodies and goat IgG conjugated to 18 nm gold particles (1 mg/ml; Jackson ImmunoResearch Laboratories, West Grove, United States). The grids for transmission electron microscopy (G4901-1VL # 3110 SPI-Grids, 300 mesh 83 µm pitch, Sigma-Aldrich, St. Louis, Missouri, United States) were coated with trinitrocellulose in the mix ethanol and diethyl ether in a ratio of 1:7. The bacterial culture samples were applied to the grid by the method for liquid suspensions (“drop on the grid”) followed by incubation for 2 minutes at room temperature. Then the grids were fixed for 1 min in (2.5% paraformaldehyde in PBS). Blocking was performed with 0.1% gelatin in PBS for 1 h. Primary antibodies were diluted in 2% BSA/PBS, incubation lasted for 1 h. Secondary antibodies were diluted 1:20 in 2% BSA/PBS, and the samples were incubated for 1 h. For contrasting, 1% uranyl acetate was used in a drop of 20 μL (20 s). To compact the resulting films, they were covered with a layer of nanocarbon. Electron microscopy was performed on a JEM-2100 transmission electron microscope (JEOL, Tokyo, Japan). Photos were taken with digital cameras: bottom port - Gatan Ultrascan 4000 16 Mpix, 4x4 K, 16 bit; side port - Gatan Erlangshen 500 1.4 Mpix, 1.3x1 K, 12 bit, 15 fps (Gatan, Pleasanton, United States).
Oral immunization of mice with live probiotic vaccine
The CBA or Balb/c mice were orally immunized by feeding with a probiotic vaccine containing an insert of NA gene (L3-NA) (30 mice per group). Mice in control groups were fed by E. faecium L3 strain (L3) or PBS. Immunization was carried out three times with an interval of 21 days. Blood serum, saliva and fecal samples were collected from 10-12 mice per group after the end of the third feeding to determine NA-specific ELISA antibodies. Saliva samples were collected from 10-12 mice per group after intraperitoneal administration of 0.1 ml of a 0.5% pilocarpine solution into the tubes containing 0.001 М of serine protease inhibitor phenylmethylsulfonyl fluoride (PMSF). To study the duration of bacterial persistence in the intestines of animals, mouse feces were collected daily and frozen at -80°C. L3-NA was qualitatively determined by spreading feces homogenate onto a selective agar surface. Enterococcal (azide) agar containing erythromycin at a concentration of 5 μg / ml was used as the elective medium. The feces samples were homogenized with a beads-shaker μT-12 (TAITEC, Saitama, Japan) at 3200 rpm for 30 s. Suspensions used contained final feces amounts of 100 μg/ml. 10 μl of the supernatant was applied to the agar surface and then the plates were incubated for 24 hours at 37°C for colonies counting.
Ethic statement
All of the animal experiments were carried out under the guidelines of the “Rules of Laboratory Practice” of the Ministry of Health of the Russian Federation N˚ 708. The study was approved by the Local Ethics Committee for Animal Care and Use at the Institute of Experimental Medicine, Saint-Petersburg, Russia, and the Protocol number 1/20 from 25.02.2020.
Determination of NA-specific IgG and IgA
Serum and local IgG and IgA levels were determined using ELISA in 96-well ELISA plates (Sarstedt, Nümbrecht, Germany) coated with A/Leningrad/134/17/57(H2N2), A/California/07/09(H1N1)pdm09 and A/South Africa/3626/13(H1N1)pdm09 (20 hemagglutination units, HAU) per 0.1 ml of the whole virus purified on sucrose gradient) overnight at 4°C as previously described [17]. Some of the samples were tested using a purified NA from A/California/07/09(H1N1)pdm09 influenza virus or a de novo-synthesized peptide based on the 222-230 B-cell epitope in the NA molecule as antigens. The endpoint ELISA titers were expressed as the highest dilution that yielded an optical density at 450 nm (OD450) greater than the mean OD450 plus 3 standard deviations of negative control wells.
Flow cytometry
Single spleen cell suspensions were prepared and stimulated with whole A/South Africa/3626/13(H1N1)pdm09 virus. Spleens were isolated from 3 mice per group after the 3rd feeding of E. faecium L3 with NA insert. Splenocytes were isolated using homogenizers for Eppendorf tubes 1.5 - 2 ml (Scientific Specialties Incorporated, USA) and purified from erythrocytes using ACK (Ammonium-Chloride-Potassium) lysing buffer. The washed cells were diluted in RPMI (Biolot, Russia) at the rate of 5 million cells per milliliter. The resulting cell suspension was stimulated with an equal volume of whole virus purified by ultracentrifugation in a sucrose gradient (A/South Africa/3626/13(H1N1)pdm09) with a HI titer of 50 HAU. The stimulants were neutralized with fetal bovine serum. The pool of stimulated cells was incubated overnight in an atmosphere with 5% CO2 at 33° C. To stop cell transport, brefeldin A (BioLegend, San Diego, CA, USA, stock 1000x) was used. To obtain a positive control, cells were stimulated with a polyclonal stimulator - staphylococcal enterotoxin B.
Cell subpopulations were determined using a BD Celesta flow cytometer (Navios, Beckman Coulter). The fluorochrome-labeled mononuclear antibodies to CD4, CD8, CD44, and CD62 (BioLegend, BioLegend, San Diego, CA, USA) served as markers of T-lymphocytes of central (Tcm) and peripheral (Tem) immunological memory of CD4 + and CD8 + cells.
Cell activation markers were fluorochrome-labeled mononuclear antibodies to interleukin 2, interferon γ, and tumor necrosis factor TNFα (BioLegend, CA, USA).
When analyzing the data, the negative control indices (non-stimulated splenocytes from non-immunized mice) were subtracted from the experimental groups.
Study of protection against influenza infection after vaccination with live probiotic vaccine
At 10 days after the end of the third immunization, the mice were intranasally infected with one 50% mouse lethal dose (MLD50) of A/South Africa/3626/13(H1N1)pdm09 influenza virus. A group of immunized mice were additionally infected with S. pneumonia serotype 3 (5x104 CFU) on 24 hours after influenza infection. To determine the lung viral titer, the lung samples were homogenized in PBS containing 100 U/ml penicillin, 100 μg/ml streptomycin and centrifuged for 10 min at 6000g. The viral titers were calculated as EID50 using hemagglutination as the endpoint as described previously [19].
Statistics
Statistical processing of the results was carried out using the GraphPad software (San Diego, CA, USA). For statistical analysis the antibody titers were expressed as log2 of the inversed final dilution. Comparisons of two independent groups was performed using the nonparametric Mann – Whitney test. The log-rank (Mantel–Cox test) was used to compare the survival distributions. The p-value < 0.05 was considered to be statistically significant.