2.1 Patients and Samples Collection
From December 2018 to August 2019, a total of 12 ligament samples were collected from patients undergoing hip replacement in the First Affiliated Hospital of Guangxi Medical University. The study population included the AS group (n = 6) and No-AS group (n = 6). The AS group included patients with AS combined with hip arthropathy. The No-AS group included 6 patients with Aseptic femoral head necrosis (AFHN).
Inclusion criteria: (1) patients with AS combined with hip arthropathy or patients with AFHN; (2) hip replacement. Exclusion criteria: (1) combined with other connective tissue diseases such as rheumatoid, systemic lupus erythematosus; (2) combined with tumor, trauma and other diseases. All tissues collected during the operation were cleaned with phosphate buffered solution (PBS, Solarbio, Beijing, China) and put into the labeled cryopreservation tubes respectively. Cryopreservation tubes were stored in a - 80 ℃ refrigerator until they were used.
General data (age, gender, Body mass index (BMI), etc.) and preoperative examination data (erythrocyte sedimentation rate (ESR), blood routine, human leukocyte antigen (HLA)-B27, etc) were collected. The diagnosis of AS was based on the revised New York standard in 1984 [16]. The diagnosis of AFHN was based on a pathological examination of femoral head [17]. We performed label free Protein analysis with the assistance of KangChen Bio-tech (Shanghai, China). All procedures were performed in compliance with the resolution of Helsinki and approved by the Local Ethics Committee. All participants received written informed consent.
2.2 Protein Preparation and Label-Free Quantification
2.2.1 Sample Lysis
The RIPA mixture is prepared immediately before use and placed on ice to cool. It is composed of RIPA lysis buffer (modified, Kangchen Bio-tech, Shanghai, China), Protease inhibitor cocktail (Kangchen Bio-tech, Shanghai, China) and 1mM PMSF (Phenylmethylsulfonyl fluoride)(Sigma-Aldrich, St. Louis, MO, USA). About 100mg sample tissue (1×10*7 cells) was thoroughly mixed with 1000 μL RIPA mixture, which was homogenized and sonicated to dissolve at 4℃ for approximately 5 minutes. After centrifugation ( speed 14000g,15min) at 4℃, the supernatant was transferred to the new ep tube and placed on ice.
2.2.2 BCA(Bicin-choninic Acid) Assay
According to the instructions of the BCA (Bicin-choninic Acid) Protein Assay Kit (Kangchen Bio-tech, Shanghai, China), reagent A and reagent B were mixed at A 50:1 ratio and added to A 96-well plate ( 160 µL/per well, 5 wells for calibration curve and 1 well for blank). 20 µL sample (dilute 5~10 times) or calibration standard protein (5 different concentration levels) was respectively added into the well. The plate were shook and incubated at 37 °C for 30min, and were read with 562 nm wave length. Protein concentration of each sample was calculated the according to the calibration curve.
2.2.3 Acetone Precipitation
For each sample, 100 µg protein was took into ep tube and diluted to 1 mg/ml by RIPA buffer. 4~6 fold volumes of pre-chilled acetone (-20 °C, Sangon Biotech, Shanghai, China) was added into the ep tube (alkylated protein), which was shook on ice for 30min or incubated at -20 °C overnight. After centrifugation (speed 10,000g, 4 °C), the supernatant was carefully discarded without disturbing the pellet. The sample was wash twice with 200 µL 80% chilled acetone.
2.2.4 Re-suspend Protein for Tryptic Digest
200 µL 1% SDC (sodium deoxycholate, Sigma-Aldrich, St. Louis, MO, USA) and 100mM ABC(Ammonium bicarbonate)(Sigma-Aldrich, St. Louis, MO, USA) was added into the ep tube, mixed with vortex and spin down. The ep tube was sonicated for 5~30min in water bath to dissolve protein. Five mmol TCEP (tris 2-carboxyethyl phosphine)(Sigma-Aldrich, St. Louis, MO, USA) was added into ep tube (sample protein), which was incubated and mixed at 55 °C for 10 min. Ten mmol IAA (iodoacetamide) (Sigma-Aldrich, St. Louis, MO, USA) was added after samples cooling down to room temperature(RT).The ep tube incubated in the dark for 15min. Trypsin(sequence grade)(Promega, Madison, WI, USA) was re-suspended with resuspension buffer to 0.5 µg / µL and incubated at RT for 5 min. Trypsin solution(protein : trypsin = 50 : 1) was added into the ep tube. They were mixed well and spun down, incubated at 37 °C with thermomixer for about 8hr or overnight.
2.2.5 Cleaning up of SDC
SDC was precipitated after 2% TFA (Trifluoroacetic Acid, HPLC)(Sigma-Aldrich, St. Louis, MO, USA) added into the ep tube. After centrifugation at top speed, supernatant was transferred to new ep tube. N * 100 µL 2% TFA was added into the pellet to extract co-precipitated peptides. The step was repeated twice. Three supernatants were merged. After centrifugation at top speed for 10-20 min, supernatant was carefully transferred to new ep tube, leaving peptide samples.
2.2.6 Peptide Desalting for Base-RP Fractionation
Buffer A (0.1% FA (Formic acid)(LC-MS, Sigma-Aldrich, St. Louis, MO, USA) ,H2O,2% ACN (Acetonitrile)(LC-MS, J.T.Baker, PA, USA))and Buffer B ( 0.1% FA,70% ACN) are prepared. C18(3M)(Sigma-Aldrich, St. Louis, MO, USA) column was equilibrated with added 500 µL ACN. ACN was washed out with 500 µL 0.1% FA 2 times. The peptide solution was added into the C18 column, After centrifugation at low speed, and liquid(A) was collected. The steps are repeated again. Peptide was eluted with 400 µL 70% ACN, and liquid(A) was collected. The desalting step (Equilibrate… to Elute…) was repeated by liquid(A) once again. Two liquid were merged and dried by vacuum under 4 °C or RT. Buffer A was added to redissolve the polypeptide to 1 buffer g/buffer L for lc-ms /MS detection or -80℃ storage.
2.2.7 Separation via Nano-UPLC
For each sample, 2 µg peptide were separated and detected with a nano-UPLC (EASY-nLC1200, Thermo Scientific, MA, USA) coupled to Q-Exactive mass spectrometry (Thermo Scientific, MA, USA). Analysis was performed using a reversed-phase column (100 µm, ID × 15 cm, Reprosil-Pur 120 C18-AQ, 1.9µm, Dr. Math). The mobile phases solution include phase A solution (0.1 % FA, 2 % ACN) and phase B solution(80 % ACN, 0.1 % FA ). The chromatographic column is balanced by 100% phase A solution. Through an automatic sampler, the samples were directly delivered to the chromatographic column to be separated at a flow rate of 300 nL/min and a gradient of 120 min. Phase B solution is used in sequence: 8 to 30 % for 92 min, 30 to 40 % for 20 min, 40 to 100 % for 2 min, 100 % for 2 min, 100 to 2 % for 2 min and 2 % for 2 min.
2.2.8 LC-MS/MS
Data dependent acquisition was performed in profile and positive mode with Orbitrap analyzer at a resolution of 70,000 (@200 m/z) and m/z range of 350-1600 for MS1; For MS2, the resolution was set to 17,500 with a dynamic first mass. The automatic gain control (AGC) target for MS1 was set to 3.0 E*6 with max IT 50ms, and 5.0 E*4 for MS2 with max IT 100ms. The top 20 most intense ions were fragmented by HCD with normalized collision energy (NCE) of 27 %, and isolation window of 2 m/z. The dynamic exclusion time window was 30 s.
2.2.9 MaxQuant Database Search
Raw MS files were processed with MaxQuant (Version 1.5.6.0). The protein sequence database (Uniprot_organism_2016_09) was downloaded from UNIPROT. This database and its reverse decoy were then searched against by MaxQuant software. The quantification type was LFQ with match between run and intensity-based absolute quantification (iBAQ); Trypsin was set as specific enzyme with up to 3 miss cleavage; Oxidation [M] and Acetyl [protein N-term] were considered as variable modification (max number of modifications per peptide is 3), Carbamidomethyl [C] was set as fixed modification; Both peptide and protein of false discovery rate (FDR) should be less than 0.01. Only unique & razor peptides were used for quantification. All the other parameters were reserved as default.
2.3 Bioinformatics Analysis
2.3.1 Differentially Expressed Proteins (DEPs)
Differentially expressed proteins (DEPs) were defined as: P < 0.01, the ratio of | AS group / No-AS group | > 2 or |Log Fold change ( FC ) |>1, unique peptide > = 2 protein. Relative protein expression values between 2 groups were compared. There were 6 biological replications in this experiment, which were tested by the t-test. False Discovery Rate (FDR) <0.05.
2.3.2 GO and KEGG Enrichment Analysis
DEPs were analyzed for GO (Gene Ontology) and KEGG(Kyoto Encyclopedia of genes and genomes) enrichment by the plugin ClueGO [18] in the Cytoscape software(version: 3.6.1) [19]. There are three categories of GO annotation: Biological process (BP), Cell compartment (CC) and Molecular function (MF) . The standard setting with statistically significant difference was P < 0.05 and Kappa score was 0.4. Bonferroni corrected P < 0.05 is considered to be valid.
2.3.3 PPI Network Construction
We integrated the DEPs into PPI network by String [20](version 11.0) to evaluate the interaction between DEPs. A composite score > 0.4 was considered to be a statistically significant interaction. Analysis data of the PPI network was loaded into Cytoscape software for visual adjustment.
2.3.4 Identification of Key Protein
Top 30 hub proteins were screened by the plug-in CytoHubba [21] in Cytoscape software from PPI networks. Key protein was selected from the correlations of hub proteins and KEGG pathways.
2.4 Cell Culture and Transfection
Fibroblasts from the two groups were separated and cultured. The fibroblasts were cultured in specific medium DMEM (10% FBS, 100μg/ mL streptomycin and 100 IU/mL penicillin) at 37℃ in a 5% CO2 incubator. Cells in the AS group were transfected with Lipofectamine 3000 (L3000015, Thermofisher Scientific, MA, USA) according to the manufacturer's instructions. The siRNA-MPO treated cells were siRNA-MPO group. As a negative control, cells treated with The siRNA-NC group were siRNA-NC group. The transfection efficiency was evaluated by Western blotting and Quantitative Real-time PCR (QPCR).
2.5Western Blotting Analysis
Western blot analysis was performed between groups. Total proteins were extracted from cell samples. BCA protein concentration determination kit (Servicebio, Wuhan, China) was used to determine the total protein concentration. The proteins are separated by 10% SDS-PAGE (Servicebio, Wuhan, China) and transferred to cellulose nitrate membrane. The membrane was sealed in 5% degreased dry milk in 37°C TBS buffer (Servicebio, Wuhan, China) for 1 hour and incubated overnight with primary antibodies (MPO antibodies, Abcam, Europe) at 4°C. Then, the membranes were washed 3 times in TBST and incubated with secondary antibodies at room temperature for 30 minutes. A scanner (EPSON V300, Japan) was used to sweep membrane and upload band data. Adobe PhotoShop (Adobe, the United States) software was used to process the color, and Alpha Innotech (Alpha Innotech, the United States) software was used to analyze the gray values of band. Relative expression level of protein = (gray value of the target protein band)/(gray value of the GAPHD protein band).
2.6 Quantitative Real-time PCR(QPCR)
According to the manufacturer's instructions, Tripure reagent (Roche, Switzerland) was applied to extract total RNA from cells. The cDNA was synthesized according to the reaction system. Next, quantitative real-time PCR(QPCR)was performed using a 2×UltraSYBR Mixture. The qPCR condition was set as follows:95°C, 10 min, 95°C, 15 sec, 60°C, 20 sec, 72°C, 25 sec, 40 cycles, followed by a 5-minute final extension at 72 °C. The 2-ΔΔCt method (Ct of target genes minus the Ct of GAPDH) [22] was used to calculate the relative expression levels of mRNA were calculated. The primer sequence of MPO is as follows: TCGGTACCCAGTTCAGGAAG (forward) and CCAGGTTCAATGCAGGAAGT (reverse).
2.7 Enzyme-linked Immunosorbent Assay (ELISA)
Enzyme-linked immunosorbent assay (ELISA) was used to detect inflammatory markers in cells before and after transfection. The concentrations of interleukin 6 (IL-6), interleukin 8 (IL-8) and tumor necrosis factor α (TNF-α) in the cell culture medium were determined by ELISA sandwich method according to the instructions of ELISA assay kit (MLBIO, Shanghai, China). The collected cell culture medium was centrifuged at 4℃ for 10 min at 1000 RPM to obtain the supernatant. The absorbance value (OD value) of each culture medium was determined at 450nm using a microplate analyzer (Mlbio, Shanghai, China). Finally, the concentrations of IL-6, IL8 and TNF-α in each sample were obtained through the standard curve equation.
2.8 Statistical Analysis
The data were expressed as the mean ± sd, and differences between 2 groups were analyzed with Student’s t-test. P < 0.05 was considered statistically significant. Bonferroni or Benjamini-Hochberg adjusted FDR, which was <0.05. Statistical analysis was performed using the Statistical Program for Social Sciences (SPSS) software 25.0 (IBM, USA).