Bacterial strains, plasmids, media and growth conditions
Bacterial strains and plasmids used in this study are summarized in Table 1. Paenibacillus polymyxa WLY78 was isolated from the rhizosphere of bamboo in Beijing (Wang et al. 2013). P. polymyxa WLY78 and ΔnifB-V mutant were routinely grown in LB medium (per liter contains: 10 g NaCl, 5 g yeast and 10 g tryptone) at 30℃ with shaking. Nitrogen-limited medium (per liter contains: 10.4 g Na2HPO4, 3.4 g KH2PO4, 26 mg CaCl2·2H2O, 30 mg MgSO4, 0.3 mg MnSO4, 36 mg Ferric citrate, 7.6 mg Na2MoO4·2H2O, 10 mg p-aminobenzoic acid, 10 mg biotin, 4 g glucose as carbon source and 0.3 g glutamic acid as nitrogen source) (Wang et al. 2013) was used for assay of nitrogenase activity (Wang et al. 2013).
Escherichia coli JM109 was used as routine cloning. Thermo-sensitive vector pRN5101 (Zhang et al. 2013) was used for gene disruption in P. polymyxa WLY78. The recombinant plasmid pGFP300 (Hao and Chen 2017) carrying the gfp gene was used for labeling P. polymyxa strains. When appropriate, antibiotics were added in the following concentrations: 100 μg/ml ampicillin, 12.5 μg/ml tetracycline and 5μg/ml erythromycin for maintenance of plasmids.
Table 1 Bacterial strains and plasmids used in this study.
Strain or plasmid
|
Genotype and/or relevant characteristics
|
Source or reference
|
strains
|
Paenibacillus polymyxa
|
|
|
WLY78
|
Wild-type strain
|
(Wang et al. 2013)
|
ΔnifB-V
|
nif gene cluster deletion mutant
|
This study
|
GFP-tagged P. polymyxa WLY78
|
P. polymyxa WLY78 carrying plasmid pGFP300; Tetr
|
(Hao and Chen 2017)
|
GFP-tagged ΔnifB-V
|
ΔnifB-V carrying plasmid pGFP300; Tetr
|
This study
|
E. coli
|
JM109
|
General cloning host; recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, Δ(lac-proAB)/F’[traD36, proAB+, lacIq, lacZΔM15]
|
Sangon Biotech Co.
|
Plasmids
|
pRN5101
|
Temperature-sensitive E. coli-Bacillus shuttle vector, Emr
|
(Zhang et al. 2013)
|
pRDnifB-V
|
nif gene cluster deletion vector based on pRN5101
|
This study
|
pGFP300
|
gfp gene in pHY300PLK
|
(Hao and Chen 2017)
|
Construction of ΔnifB-V mutant of P. polymyxa WLY78
The nitrogen-fixing gene cluster deletion mutant ΔnifB-V of P. polymyxa WLY78 was constructed by a homologous recombination method. For doing this, the upstream fragment and downstream fragment flanking nif gene cluster were amplified by PCR using Phanta®Max Super-Fidelity DNA Polymerase (Vazyme Biotech Co., Ltd., Nanjing, China), respectively. Primer 1 (5′ CGGCCACGATGCGTCCGGCGTAGAGGATCCGCGTGGTG
GATGTGGA CG 3′) and Primer 2 (5′ AACGCTTTTTCGGTTATCATTCCTTCACATCTATTTTCGTC 3′) were
used to amplify a 950 bp-long sequence located upstream of nifB. Primer3 (5′ GAAGGAATGATAACCGAAAA
AGCGTTCCCGTC 3′) and Primer 4 (5′ GACTGCGCAAAAGACATAATCGATAAGCTTCCTGATAAGGCAG
ACAAGGCTC 3′) were used to amplify a 1107 bp-long sequence located downstream of nifV. The two fragments were then fused with BamH Ⅰ/Hind III digested pRN5101 vector using Gibson assembly master mix (New England Biolabs), generating the recombinant plasmid pRDnifB-V. Then, the recombinant plasmid pRDnifB-V was transformed into P. polymyxa WLY78 as described by Wang et al., (2018), and the marker-free deletion mutant (the double-crossover transformant) ΔnifB-V was selected from the initial erythromycin resistance (Emr) transformants after several rounds of nonselective growth at 39˚C and confirmed by PCR using the primer 5 (5′ GCATAAATTGTACACGTTGA 3′) and primer 6 (5′ AGGCTCATAAACACCGTATC 3′).
Growth and nitrogenase activity of the wild type and mutant strains
To measure growth, P. polymyxa WLY78 and ΔnifB-V were grown in 20 mL of LB media in 50 mL flasks shaken at 200 rpm at 30°C to logarithmic growth phase. The cultures were collected by centrifugation, washed three times with sterilized water and then resuspended in sufficient nitrogen medium (nitrogen-limited medium supplemented with 100 mM NH4Cl) to a start OD600 of 0.02. Every 2 h, the growth of P. polymyxa WLY78 and ΔnifB-V mutant strains were determined by absorbancy at 600 nm.
Acetylene reduction assays were performed as described previously to measure nitrogenase activity (Wang et al. 2013). P. polymyxa WLY78 and ΔnifB-V mutant strains were grown in 50 mL of LB medium overnight. The cultures were collected by centrifugation, washed three times with sterilized water, and then resuspended in a nitrogen-limited medium to a final OD600 of 0.4. Then, 4 mL of the culture was transferred to a 26-mL test tube and the test tube was sealed with a rubber stopper. The headspace in the tube was then evacuated and replaced with argon gas. Then, approximately 2.2 mL of C2H2 (10% of the headspace volume) was injected into the test tubes. After incubating the cultures at 30 ℃ for the corresponding time, a 100 µL gas sample was taken out and injected into gas chromatography to quantify ethylene (C2H4) production. The nitrogenase activity was expressed in nmol C2H4/mg protein/h.
Preparation of soil, seeds and bacterial suspension
The soil (0-20 cm deep topsoil) was taken from the Shangzhuang Experimental Station of China Agricultural University. The soil was low nitrogen (7.8 mg kg−1) sandy soil. After the soil was air-dried and crushed, the debris were removed with a 2 mm sieve to reduce heterogeneity, and then packed into plastic pots with a diameter of 20 cm and a height of 14 cm. Each pot was filled with 2 kg of soil to grow cucumbers. No trace elements were applied during plant growth.
Cucumber seeds (“Zhongnong 8” of Beijing Shengfeng Garden Agricultural Technology Co., Ltd.) were first disinfected with 10% sodium hypochlorite for 10 minutes, then were rinsed with sterile water three times, and finally were distributed in a sterile petri dish with damp filter paper at room temperature (25℃) for 3-5 days in the dark.
The bacterial suspension of P. polymyxa WLY78 and ΔnifB-V used in inoculation was prepared as follows. P. polymyxa WLY78 and ΔnifB-V were inoculated into LB liquid medium, cultured at 30°C and 180 rpm to logarithmic growth phase, and then harvested by centrifugation and finally suspended with physiological saline (0.89% w/v NaCl in deionized water). The cell concentration was set to 108 cells mL-1.
Colonization of P. polymyxa and ΔnifB-V on cucumber
The recombinant plasmid pGFP300 carrying the gfp gene was transferred into ΔnifB-V by electrotransformation as described in P. polymyxa WLY78 (Hao and Chen 2017), yielding GFP-tagged ΔnifB-V mutant. The GFP-tagged ΔnifB-V mutant and GFP-tagged P. polymyxa WLY78 suspension were obtained as described above to final concentration at 108 cells mL-1. The sterilized cucumber seeds were sown in sterile glass bottles containing 100 mL of 1/2 MS semi-solid agar medium, and one seed was placed in each bottle. After dark treatment for about a week, the seeds were grown into seedlings, which were transferred to a light incubator (27℃, 70% humidity and 16 h day/8 h night, with light at 250 µmol m−2 s−1) for cultivation. The seedlings were regularly watered (tap water) to 40% relative soil moisture by weighing method every 5 days. After the seedlings grow 2-3 young leaves, inoculate the cell suspension of GFP-tagged strains at the root of cucumber. Three days later, the colonization of GFP-labeled strains in cucumber tissues were placed on a slide and visualized with an excitation wavelength of 488 nm with a laser confocal scanning microscope (CLSM, Olympus FluoViewTM FV1000 confocal microscope). The emitted light was collected in the 500-565 nm range for GFP, and the images were collected with FV10-ASW software (03.01.02.02, Olympus Europa Holding GmbH, Hamburg Germany).
Greenhouse pot experiment
The research was conducted in the greenhouse of China Agricultural University using greenhouse potting. The experimental design was arranged by random factors, with three inoculation treatments and two nitrogen level treatments. Each treatment was repeated three times, for a total of 18 pots of cucumber plants. Nitrogen level treatment included high nitrogen and low nitrogen levels. Nitrogen fertilizer was applied in the form of 15N labeled (NH4)2SO4 (10.16% 15N atom, Shanghai Research Institute of Chemical Industry, China). The high nitrogen level was 250 mg N kg-1 soil, and the low nitrogen level was 83 mg N kg-1 soil. Nitrogen fertilizer was applied in three times, one-third each time, and the first time was applied as a base fertilizer, followed by 7 and 14 days after transplantation.
The inoculation treatment included three treatments: inoculation of P. polymyxa WLY78 (WT), ΔnifB-V, and equal amount of physiological saline (as a control). The germinated cucumber seeds with robust and consistent growth were picked and immersed in the bacterial suspension for 20 minutes. The seeds were immersed in physiological saline for 20 minutes as a control group, and then transplanted into plastic pots. Four seeds were planted in each pot, and three repetitions were set for each treatment. In the first and second weeks after planting, the P. polymyxa WLY78 and ΔnifB-V bacterial suspensions were re-inoculated into the roots of the plants, and the control group was added with the same amount of physiological saline. Place the flower pots under the best conditions in the greenhouse (15 h light/9 h dark cycle, 25–30/15–20℃ day/night temperature and 40% day/60% night humidity). The seedlings were regularly watered every 3 days until the relative humidity of the soil reached 40%.
Plant sample collection
On 30th day of cucumber planting, the plants were collected by destructive sampling. The whole seedling was first uprooted, and rinsed with deionized water to remove the soil attached to the root system, then the root and shoot samples were separated, and the length of the root and shoot were measured. The root and shoot samples were killed in an oven at 105°C for 30 minutes, and then dried at 65°C until constant weight for dry weight analysis. Then the dried samples were immediately frozen in liquid nitrogen for subsequent analysis.
Contribution of nitrogen by biological nitrogen fixation
The 15N isotope dilution technique was used to quantitatively determine the contribution of inoculated bacteria to cucumber biological nitrogen fixation. The above dried sample was ground, sieved with a 1 mm sieve and placed in a bag, and the cucumber N content and 15N enrichment determination were performed by DELTA V Advantage isotope ratio mass spectrometer (Thermo Fisher Scientific, Inc., United States). The cucumber without inoculation were used as references to calculate the BNF contribution. After inoculation with P. polymyxa WLY78 and ΔnifB-V, the percentage of nitrogen from cucumber biological nitrogen fixation to the nitrogen content in cucumber (% Ndfa) was calculated by the following formula:
Among them, %NdfF is the 15N enrichment of cucumber stems and leaves of inoculation treatment, and% NdfNF is the 15N enrichment of cucumber stems and leaves of uninoculated treatment (control group).
Statistical Analysis
Graphs were prepared using GraphPad Prism software v. 8.0 (GraphPad Software Inc., San Diego, CA, USA). Statistical analysis was performed using SPSS software version 20 (SPSS Inc., Chicago, IL, United States). One-way analysis of variance (ANOVA) was employed to check the significant differences between treatments. Means of different treatments were compared using the least significant difference (LSD) at the 0.05 or 0.01 level of probability.