Polychaete worm and adaptation
The polychaete P. aibuhitensis (1.5–2.5 g wet weight) was collected at low tide from Liaohe Estuary in Liaoning Province, China. The animals and the sediment in the sampling site were put in an ice cooler and transferred to the laboratory where they were cultured in glass tanks (50 cm × 40 cm × 40 cm) with seawater and origin sediment. The seawater used in this experiment was pumped from the Dalian coast adjacent to Lingshui Bay, where the experiment was conducted, and then filtered using a composite sand filter into a large reservoir tank. The animals were acclimated for one week with the animal density at ca. 100 ind. m− 2 before placement under exposure conditions. The seawater was changed completely daily during the acclimatization, and aeration was provided continuously, water temperature was 17°C, salinity was 30, and photoperiod was 12L:12D. The worms were fed excessively with a commercially formulated diet (13.0% moisture, 44.7% crude protein, 26.1% crude lipid, and 10.8% ash).
Cloning of full-length cDNA of CYP4
Total RNA was extracted from the body wall of P. aibuhitensis using RNAiso Plus (TaKaRa, Dalian, China) according to the manufacturer’s instructions. The quality and quantity of total RNA were determined by electrophoresis in 1.0% (w/v) agarose gel and an ultramicro spectrophotometer, respectively.
The partial sequence fragment of CYP4V82 was amplified through homology cloning technique with the primes based on the conserved amino acids of Neanthes virens CYP4BB1 (Genbank No: AY453407), CYP342A1 (Genbank No: AY453408), Capitella sp CYP4AT1 (Genbank No: AY574044), and CYP331A1 (Genbank No:AY574043) (Table 1). The reaction for CYP4V82 partial sequence was conducted with nest PCR. The inner and outer PCR conditions were the same, and the procedure was conducted followed by 94 ºC for 3 min, 30 cycles of 94 ºC for 30 s, 55 ºC for 30 s, and 72 ºC for 2 min.
Table 1 The primer used in this experiment
Application
|
Primer name
|
Primer Sequence (5’-3’)
|
Degenerate primer
RACE primer
|
CYP4F1
CYP4F2
CYP4R1
CYP4R2
|
TGATACGTTTATGTTTGAGGG
ATGCAATTTCTGGGGCCAGC
ATGTTTGARGGDCAWGAMAC
AATNTTGNCCHATRCARTT
|
RACE-CYP4F2
RACE-CYP4F3
|
CGGGAGTAATCGCGCTATCACC
CGCTTATTCCCCTCAGTACCAA
|
RACE-CYP4R2
RACE-CYP4R3
|
CGTTTTCGGTATATCTACACCA
CATACATTGGTACTGAGGGGAA
|
actin- F1
actin- R1
|
TCTCGTAGTTGACAATGG
CTTCAGTGTGAGGATACC
|
Real time PCR primer
|
CYP4V82-F4
CYP4V82-R4
CYP4BB4-F1
CYP4BB4-R1
|
ATCACGGTCTGCTCATTCC
AAGAGTGCTGTATTCAAGAACC
GTGCCCCTAATCAGCCGA
GCAGTTTCTTGGCCCTGC
|
The full-length cDNA of CYP4V82 based on the partial sequence fragment was obtained by the procedures of rapid amplification of cDNA ends (RACE) method using TaKaRa LA Taq® with a GC buffer Kit (TaKaRa, Dalian, China). 5′ and 3′ RACE-PCRs were also performed by nested PCR with the specific primer in Table 1. The inner and outer PCR conditions were the same. The reaction protocol of 3′ RACE for CYP4V82 was as follows: 94 ºC for 3 min; followed by 30 cycles at 94 ºC for 30 s, 55 ºC for 30 s, 72 ºC for 1 min; finally, an extension step at 72ºC for 10 min. The 5′ RACE protocol for CYP4V82 was as follows: 94 ºC for 3 min; followed by 30 cycles at 94 ºC for 30 s, 55 ºC for 30 s, and 72 ºC for 1 min; finally, 72 ºC for 10 min. The PCR products were determined by electrophoresis in 1% agarose gel, and the amplified cDNA fragments were purified using a gel extraction kit (TaKaRa, Dalian, China) and sequenced by Takara Biotechnology (Dalian) Co., LTD.
Sequence analysis
The complete cDNA of P. aibuhitensis CYP4V82 was analyzed through ORF Finder on NCBI to find the open reading frame (ORF). The deduced amino acid sequence was obtained using the Expert Protein Analysis system (http://www.us.expasy.org/tools). The functional sites and motifs of CYP4V82 were respectively predicted with Expasy (http://www.au.expasy.org/prosite/) and Motif Scan (http://myhits.isb-sib.ch/cgi-bin/motif_scan). The similarity of CYP4V82 sequence was examined with the BLAST program (http://www.ncbi.nlm.nih.gov). Multiple sequence alignment was analyzed with Clustal W software, and the phylogeny of the CYP4 family was examined using Mega 5.0 software. A bootstrap test was calculated from 1000 replicates.
PAH exposure
Sea sand was collected in the worm sampling site of origin and used in the experiment to provide refuge for P. aibuhitensis. The sand underwent combustion (550°C for 12 h) and acidification (10% HNO3 [V/V]) to remove the organic matter. The handled sand was dried at 65°C for further use. This process was conducted to avoid the adsorption of organic matter to PAHs. Three kinds of PAHs, namely Phenanthrene (Phe), Fluoranthene (Flu), and Benzo(a)pyrene (B(a)P), were selected as pollutants. The Phe, Flu, and B(a)P standards were analytically pure and purchased from Sigma–Aldrich Corporation (Shanghai), U.S. The three PAHs respectively represent 3-, 4-, and 5-benzene ring PAHs. Four concentrations of B(a)P (0.5, 2, 4, and 8 µg/L) were set in accordance with the water solubility of B(a)P (3.8 µg/L, Sverdrup et al. 2002). A 16 nM Phe (2.9 µg/L), Flu (3.2 µg/L), and B(a)P (4 µg/L) was also established to demonstrate the CYP4 biotransformation to the same molecular but different ringed PAHs. The concentration of different kinds of PAHs in the exposure experiment was analyzed through Agilent 6890 gas chromatography coupled with Agilent 5975B mass spectrometry (Agilent Co., USA) to improve the concentration accuracy in the experiment. The actual concentration in each concentration group was detected before renewing the water, and the concentration of each group was as follows: 0.35 ± 0.025 µg/L B(a)P, 1.26 ± 0.024 µg/L B(a)P, 3.29 ± 0.301 µg/L B(a)P, 6.54 ± 0.167 µg/L B(a)P, 2.42 ± 0.203 µg/L Flu, and 2.04 ± 0.317 µg/L Phe. All three kinds of PAHs need a solvent carrier to dissolve in seawater. Therefore, a solvent control group (100 µL/L acetone) and a blank control group were set in this study.
Experimental worms were randomly put into 2 L plastic beakers containing 1500 ml seawater and a 2–3 cm layer of sand. Each group set three repetitions. The seawater was changed daily with the temperature maintained at 17 ± 1°C, and commercially formulated diet was provided twice a day (9:00 and 16:00). Three individuals were sampled in each treatment at days 7 and 14 during exposure, and the samples were stored and frozen for further analysis.
Relative qualification of CYP 4 mRNA expression
The expression patterns of CYP4BB4 (Chen et al. 2012) and CYP4V82 obtained in this study were detected by real-time PCR to compare the mRNA expression of different CYP4 under PAH exposure. Gene-specific primers (Table 1) were designed on the basis of the full-length cDNA of each gene. According to the report of Chen et al. (2012) the actin gene was used as a housekeeping gene in this study. The first-strand cDNA was synthesized from total RNA (500 ng/µL) using a PrimeScript RT reagent Kit with a gDNA Eraser (TaKaRa, Dalian, China).
The quantitative real-time PCR was performed on ABI 7500 Sequence Detection System (Applied Biosystems, CA, USA). The reaction was conducted in triplicates in the total volume of 20 µL containing 10 µL of SYBR Premix Ex TaqTM II, 0.4 µL of ROX Reference Dye, 0.8 µL of each primer, 1.0 µL of cDNA, and 7.0 µL of double-distilled water. The amplification profile was 95 ºC for 30 s, followed by 40 cycles at 95°C for 5 s and 60°C for 34 s. Dissociation curve analysis of amplification products was performed at the end of each PCR to confirm the specificity of the PCR product.
Statistical analysis
The 2−△△Ct method was used to analyze the relative expression level of CYP mRNA under PAH exposure. All data were reported as mean ± S.D. The difference among B(a)P concentrations and different kinds of PAHs within a sampling time was determined using one-way analysis of variance followed by Tukey’s test using SPSS19.0 software. Statistically significant difference was set at P ≤ 0.05.