Animals
Male APP/PS1-21 mice on a C57BL/6J background were obtained from Prof. M. Jucker (University of Tuebingen, Germany). Heterozygous male APP/PS1-21 mice were bred with wild-type C57BL/6J females (Charles River Germany, Sulzfeld, Germany). Offspring were tail-snipped and genotyped using PCR with primers specific for the APP-sequence (forward, “GAATTCCGACATGACTCAGG”; reverse, “GTTCTGCTGCATCTTGGACA”). Animals were housed under a 12-hour light/ dark cycle with free access to food and water. All experiments and protocols were licensed and approved by the local government in Germany, according to The German Animal Welfare Act (TierSchG) of 2006; or by Nanjing Medical University Animal Care and Use Committee in accordance with the regulations of the ethics committee of the International Association for the Study of Pain and the Guide for the Care and Use of Laboratory Animals (The Ministry of Science and Technology of China, 2006) in China.
Reagents
DMEM/F-12 medium, fetal bovine serum (FBS), penicillin, and streptomycin were purchased from Gibco (Waltham, MA, USA). The Aβ used in these experiments was human Aβ1-42 (ChinaPeptides, Shanghai, China). The Aβ powder was dissolved and incubated in DMSO, and was then diluted to a stock solution (500 μM) with phosphate buffered saline (PBS; Boster Biological Technology, Wuhan, China). Before the experiments, we incubated the mixed stock solution at 37°C for 24 hours. Zerumbone (Zer, > 98% of Purity, Fig. 1) and lipopolysaccharide (LPS) were purchased from Sigma-Aldrich (Munich, Germany). Zerumbone was dissolved in DMSO to produce a 20 μM stock solution. Same volume or amount of DMSO and/or PBS was applied as vehicles. For the in vitro experiments, stock solutions of Aβ or zerumbone were further diluted to different working concentrations with culture media. After 6 hours of pretreatment of Zer or vehicle, we treated the cells with the 10uM Aβ1-42 for 12 hours. The dose of amyloid beta used in cell culture experiments is based on our previous studies and is consistent with the majority of previous in vitro studies on AD. We tested serial concentrations of amyloid beta from 1 to 30 uM and 10 uM was an appropriate concentration, which didn’t harm the cellular activity in our cell culture.
Cell culture
Primary microglia were isolated from the cortex of newborn (postnatal day 0–2) C57BL/6J mice by mild trypsinization as previously described[44]. Briefly, the cortex was chopped and digested into a single cell suspension which was incubated in DMEM/F-12 containing 10% FBS and 100 U/ml 1% penicillin/streptomycin. After 15 days of incubation, mixed glial cells were shaken for two hours at 37 °C. Detached microglia were then harvested for the subsequent experiments. In some experiments, primary microglia were also isolated from brain homogenates as previously described with minor modifications[45]. Briefly, the brains of zerumbone-treated or control mice were minced and finely homogenized in ice-cold Hank’s Balanced Salt Solution (HBSS, pH 7.4). The homogenates were centrifuged twice at 250 g for 5 minutes. The pellet was re-suspended in 1 ml 70% isotonic Percoll (GE Healthcare, Uppsala, Sweden). A discontinuous Percoll density gradient was layered as follows: 70%, 50%, and 35% isotonic Percoll, and PBS. The gradient was centrifuged at 1200 g for 45 minutes at 4 °C, and microglia were collected from the 70/50 % interphase Percoll layers.
Isolated cells were washed and re-suspended in sterile HBSS, and were then stained with PE-conjugated anti-CD11b and FITC-conjugated anti-CD45 antibodies (1:1000, Serotec, Oxford, UK). The purity of CD11b+/CD45low microglia was confirmed to be >85%. The primary microglia were grown in DMEM medium at 37 °C and 5% CO2. All cultures were supplemented with penicillin/streptomycin (100 U/ml) and 10% FBS. Subsequently, 105 cells were seeded onto 12-well cell culture plates and cultured.
Cell viability assays
Cell viability was evaluated using a Cell Counting Kit-8 (CCK-8; Yeasen, Shanghai, China). Briefly, after each treatment, 10 µl of CCK-8 reagent was added and microglia were incubated for 4 hours at 37 °C and 5% CO2. The absorbance of the samples was measured at 450 nm using a microplate reader. Cell viability was determined using the following calculation: cell viability (%) = (A (stimulated) – A (blank) / (A (control) – A (blank) × 100%.
RNA isolation and real-time PCR
To determine the effects of zerumbone on the inflammatory response of microglia in vitro, N9 microglial cells and primary microglial cells were used. As previously mentioned, all cells were cultured in DMEM medium with 100 U/ml penicillin/streptomycin and 10% FBS. The cells were seeded in 12-well plates, and were then divided into three groups. Cells in the vehicle group were treated with a solution of Aβ1-42. Cells in the Aβ group were treated with 10 μM Aβ1-42 for 24 hours. Cells in the Zer group were pre-treated with zerumbone (at concentrations of 1, 3, or 10 µg/ml) for 24 hours before treatment.
Total RNA was extracted from cells using the RNeasy Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer’s protocol. The QuantiTect Reverse Transcription Kit (QIAGEN) was used to reverse transcribe RNA (1 μg) into cDNA. Real-time PCR analysis was performed using ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China) to measure the mRNA expression of IL-1β, IL-6, iNOS, TNF-α, CD206, IL-10, and ARG-1. The amplification efficiency of these primers had previously been established using calibration curves. Each 20 μl qPCR reaction mixture contained 3 μl water, 1 μl forward primer (20 μmol/l), 1 μl reverse primer (20 μmol/l), 10 μl MasterMix, and 50 ng cDNA. PCR amplification was conducted as follows: denaturation at 95 °C for 10 minutes, 40 cycles of 95 °C for 10 seconds and 65 °C for 60 seconds, followed by 1 cycle at 97 °C for 1 second. Finally, a melting step was performed consisting of 10 seconds at 95°C, 60 seconds at 65°C, and slow heating at a rate of 0.1 °C per second to 97 °C with continuous fluorescence measurement. Quantification was performed using the comparative CQ method (2−ΔΔCQ). The expression of each target mRNA was calculated relative to that of β-actin (four samples from each group were analyzed by PCR)[46, 47].
Nitric oxide detection and enzyme-linked immunosorbent assay
Supernatants from different wells were collected and a standard Griess assay (Sigma-Aldrich) was performed to analyze the production of nitric oxide (NO). Enzyme-linked immunosorbent assay (ELISA) kits for IL-1β (Thermo Scientific, Waltham, MA, USA), TNF-α, IL-10, and prostaglandin E2 (PGE2; BioLegend Inc., San Diego, CA, USA) were used to detect the concentrations of these cytokines in microglial culture supernatants. To further confirm the role of the MAPK pathway in the effects of zerumbone, microglia were pre-treated for 2 hours with 10 μM U0126 (an ERK inhibitor), SB202190 (a p38 inhibitor), or BAY 11-7082 (a NF-κB inhibitor), and further cultured with 3 μg/ml zerumbone. ELISAs were then conducted to determine the effects of zerumbone on the release of IL-1β, TNF-α, and IL-10. Protein from half-brains was serially extracted to produce soluble and insoluble protein fractions. Brains were homogenized with a tissue mite homogenizer for 15 seconds in PBS twice, and then sonicated. Homogenates were cleared by centrifugation at 12,000g for 45 minutes at 4 °C. The resulting supernatant was labelled as the soluble fraction. The pellet was re suspended in 1ml of guanidine hydrochloride (5 M guanidine hydrochloride in 1 M Tris, pH 8.0) by pipetting followed by rotation overnight at room temperature and labeled as the insoluble fraction. The concentrations of Aβ were also measured by ELISA kit (Wako, Osaka, Japan) at A450 nm. All samples were analyzed four times.
Flow cytometry analysis
To detect the effects of zerumbone on Aβ phagocytosis, microglia were stimulated with Aβ1-42 and incubated with or without zerumbone (3 µg/ml) for 24 hours. Each tube of cells was incubated with 1 µl (500 ng/µL) Aβ1-42 (HiLyteTM Fluor 488-labeled, Eurogentec, Liege, Belgium) for 1 hour at 4 °C. Data were analyzed using FlowJo Software (Version 7.6.1; TreeStar, Ashland, OR, USA).
Western blot analysis
To identify the signaling pathway involved in the effects of zerumbone, total protein was extracted from primary microglia and the brains of vehicle- and zerumbone-treated APP/PS1 mice using RIPA lysis buffer (50 mM Tris, 150 mM NaCl, 1% TritonX-100, 1% sodium deoxycholate, and 1% SDS). The volumes and contents of all samples were equalized with RIPA lysis buffer, and the samples were electrophoretically separated on 12% SDS-PAGE gels. Following this, the proteins were transferred to PVDF membranes (Millipore, Billerica, MA, USA) using Trans-Blot apparatus (Bio-Rad, Hercules, CA, USA). The membranes were blocked with Tris-buffered saline solution (TBS) containing 5% bovine serum albumin (BSA) for 2 hours, and were then incubated at 4 °C overnight with primary antibodies against cyclooxygenase-2 (Cox-2), microsomal prostaglandin E synthase-1 (m-PGES-1), ERK, p38 MAPK, NF-κB p65 (1:1000, Abcam, Cambridge, MA, USA), and β-actin (1:500, Sigma, St. Louis, MO, USA). The proteins were visualized using appropriate horseradish peroxidase–conjugated secondary antibodies and an enhanced chemiluminescence reagent. The signals of specific proteins were detected using a Gel Doc imager (Bio-Rad), and were expressed as a fraction of the signal of the control protein [48, 49].
Mouse treatment and groups
In order to be administered orally, zerumbone was suspended in 1% carboxymethylcellulose (CMC, Blanose®, Hercules-Aqualon, Düsseldorf, Germany) at a concentration of 3.5 mg/ml (zerumbone/CMC solution). Five-month-old mice were divided into two groups. Group 1 comprised seven APP/PS1-21 mice (five males and two females) which were treated for 20 days with zerumbone (25 mg/kg by daily gavage). Group 2 comprised seven sex- and age-matched APP/PS1-21 mice which were administered the same volume (200 µl) of 1% CMC dissolved in water.
Design and evaluation of nest construction assay
A nest construction assay[50] was modified to identify deficits in the affiliative/social behavior of APP/PS1 mice and potential changes following treatment.
For at least 24 hours, mice were individually housed in clean plastic cages with wood chip bedding (approximately 1 cm deep) lining the floor. Identification cards were coded to render the experimenter blind to the sex, age, and genotype of the mice. Two hours prior to the onset of the dark phase of the light/dark cycle, a 20 × 20 cm piece of paper towel torn into approximately 5 × 5 cm square pieces was placed in each cage. Mice were tested in balanced groups of mixed genotypes to reduce variability in housing conditions. The next morning (approximately 16 hours later), the cages were inspected for nest construction. Pictures were taken prior to evaluation for documentation. Paper towel nest construction was scored using a 3-point system: 1 = no biting or tears on the paper, 2 = moderate biting and/or tears on the paper but no coherent nest (not grouped into a corner of the cage), and 3 = the vast majority of paper torn into pieces and grouped into a corner of the cage[50, 51].
Social interaction: resident-intruder assay
The social interaction assay was performed according to previous studies[51, 52] with minor modifications. The resident-intruder assay was video-recorded to evaluate all distinct behaviors of vehicle-treated and zerumbone-treated WT or AD mice (residents) in the presence and absence of an intruder mouse, and to analyze the movement of the mice to assess their overall activity level and overt neurobiological differences. In this assay, the observer was blinded to treatment allocation. A mouse was placed in a clean plastic cage identical to its home cage (325 mm × 210 mm × 185 mm) for 15 minutes to establish it as the “resident” mouse. An age-, weight-, and sex-matched untreated naive mouse (the “intruder mouse”) was then introduced for a second 15-minute period.
The numbers of independent (15 minutes without intruder and 15 minutes with intruder) and interactive behavioral events (15 minutes with intruder) were counted for the resident mouse. Independent behavioral events included sniffing the environment, rearing alongside the cage, rearing independently, digging, circling clockwise, circling counter-clockwise, allogrooming, freezing, and scratching. Interactive behavioral events included sniffing the other mouse, following, grooming, rearing at the other mouse, sitting or lying next to the other mouse, backing or running away from the other mouse, biting, boxing or wrestling, mounting, pinning, and tail-rattling. The recorded videos were analyzed, and the numbers of events were counted by three independent observers blinded to treatment allocation.
To calculate the total distance traveled and quantify all identifiable distinct behaviors, both 15-minute sessions were videotaped at a frame rate of 15 Hz. This sampling rate ensured that fast movements of the mice were sufficiently captured and allowed for a fine-grained analysis of the trajectory of these movements, but maintained manageable file sizes. A region of interest in the captured video (500 × 310 pixels) was saved directly to a computer for later analysis.
Following acquisition of the video, the position of the mouse was localized in each frame. Tracking was performed using Java-based software (Oracle, Redwood City, CA, USA) [53]. To determine the location of the mouse in each frame, the pixel of maximum intensity was identified, and a subset image around this pixel was extracted. The center of intensity of the subset image was calculated and used to determine the object’s X and Y locations. The total distance traveled per transgenic mouse was then calculated using mouse behavior analysis software developed in our lab.
Novel object recognition test
In the training phase of the novel object recognition test, each mouse was placed into the experimental arena with two identical green objects (5 × 5 × 5 cm) and allowed to explore for 10 minutes. Twenty-four hours later, the novel object preference test (10 minutes) was conducted. The mouse was placed in the arena and presented with two objects in the same position as before, one familiar object and one novel red plastic object (3.5 × 4 × 6 cm). The length of time that the animal spent exploring the novel object was recorded. The recognition index (RI) was determined using the following calculation: recognition index = the length of time spent exploring the novel object/the total length of time spent exploring both objects × 100.
Morris water maze test
The Morris water maze (MWM) test was conducted in a circular tank (120 cm diameter, 60 cm height). The depth of the water was 0.3 m, and the temperature of the water was 23–25 °C. A platform (7.5 cm diameter) was placed in one quadrant of the pool, 13 cm from the edge. After one day of habitation, training was initiated, and each mouse underwent three 1-minute trials per day. After 4 days of training, the probe test was then conducted. The escape latency of each mouse, defined as the time taken to find the hidden platform, was recorded and analyzed.
Immunohistochemistry and image analysis
Zerumbone- and vehicle-treated mice were sacrificed after 20 days of treatment. The mice were deeply anesthetized with ether and perfused intracardially with ice-cold 4% paraformaldehyde in PBS. The brains were quickly removed and post-fixed in 4% paraformaldehyde overnight at 4 °C. The post-fixed brains were cut into two hemispheres. Both hemispheres were embedded in paraffin, serially sectioned (3-μm thickness), and mounted on silane-covered slides. These sections were then stained via immunohistochemistry as described previously [54]. The following antibodies were used: anti-Aβ (1:100, Abcam) for Aβ deposition, anti-ionized calcium binding adaptor molecule-1 (Iba-1; 1:200, Wako, Neuss, Germany) for activated microglia, and anti-CD206 (1:100, Biorbyt, Cambridge, UK) for M2 microglia. The rabbit polyclonal anti-Aβ antibody (ab2539) was generated against the synthetic peptide DAEFRHDSGYEVHH conjugated to Keyhole Limpet Hemocyanin (KLH), corresponding to amino acids 1–14 of human Aβ.
CD206, widely known as the mannose receptor, is expressed by many types of cell, including macrophages and various epithelial cells. CD206 is expressed by microglia with an anti-inflammatory phenotype, but not by those with a pro-inflammatory phenotype, and is therefore used as a marker of anti-inflammatory microglia [55]. A double-staining experiment with anti-Iba-1 and anti-CD206 antibodies was performed. After the brain tissue sections were immune-labeled with Iba-1 as previously described, they were once more irradiated and incubated with the primary anti-CD206 antibody for 2 hours at 20 °C. Immunostaining was developed with Fast Blue BB salt chromogen-substrate solution, but counterstaining with hemalum was not performed.
After immunostaining, the hemisphere sections were examined using a light microscope (Nikon Coolscope; Nikon, Tokyo, Japan). Aβ and Iba-1 immunostaining were evaluated in the hemisphere sections, particularly in the cortex and the hippocampus. All sections were randomly numbered and analyzed independently by two observers, who were blinded to the treatment and time points. The numbers of Aβ plaques and Iba-1-positive cells in the cortex and hippocampus were counted under a microscope at 50×magnification. Small Aβ plaques with a dense core and larger plaques with a dense core and a large halo of diffuse amyloid were counted. Small areas or spots of Aβ staining, smaller than a cellular nucleus (approximately 10 μm of diameter), and slightly stained diffuse amyloid without a dense core were classified as unclear deposition and were not counted. Furthermore, images of the hemisphere sections were captured using a Nikon Coolscope (Nikon) with fixed parameters. The cortex and the hippocampus were outlined on the images and analyzed using MetaMorph Offline 7.1 software (Molecular Devices, Toronto, Canada). The percentage areas of Aβ, Iba-1, CD206, and CD206+Iba-1 in the regions of interest were determined using color threshold segmentation. All parameters were fixed for all images of a specific stain. Results are presented as the arithmetic mean of plaque/cell counts or percentage areas of immunoreactivity (IR) in an area of interest in the cross-sections and the standard error of the mean (SEM). Additionally, the ratios of CD206 immunoreactivity to Iba-1 IR and the ratios of double staining IR to Iba-1 or Aβ IR were calculated and presented in bar graphs.
Immunofluorescence and confocal analysis
For the NF-κB activation assay, vehicle-, Aβ-, and zerumbone-treated N9 cells were plated in confocal cell culture dishes. The cells were then fixed with ice-cold methanol, permeabilized with 0.25% Triton X-100/TBST, and blocked with 1% BSA in TBST for 1 hour. The cells were incubated with an antip65/RelA antibody (1:100, Abcam) for 2 h at room temperature and Alexa Fluor 647-conjugated secondary antibodies (1:1000, Cell Signaling Technology, Beverly, MA, USA) at room temperature for 1 hour. To identify synaptic loss, the brains of AD mice with or without Zerumbone treatment were fixed with paraformaldehyde, paraffin-embedded and serially sectioned into 3 μm thickness. These sections were incubated with primary antibody against synapse (1:300, Abcam) overnight at 4 °C and Alexa Fluor 488-conjugated secondary antibody (1:500, Abcam) for 1 hour at room temperature. Finally, the nuclei were stained with 4’, 6-diamidino-2-phenyl-indole (DAPI; SouthernBiotech, Birmingham, Ala, USA). Confocal microscopy was carried out using a Zeiss Axiovert system (LSM510; Carl Zeiss, Jena, Germany).
To detect Aβ in brain tissue, anesthetized animals were perfused transcardially with 4% paraformaldehyde. The brains were immediately removed, post-fixed in the same paraformaldehyde solution, and transferred to 30% sucrose solution at 4 °C. The specimens were then embedded in Tissue-Tek® O.C.T compound and frozen at -80 °C. Specimens were cut into 25-μm-thick sections by a freezing microtome (CM1860; Leica, Wetzlar, Germany) and incubated overnight at 4 °C with antibodies against Aβ (1:200, Abcam, Iba-1, or glial fibrillary acidic protein (GFAP; 1:500, Novus Biologicals, Abingdon, UK). After washing, the sections were incubated with Alexa Fluor-conjugated secondary antibodies for 1 hour at room temperature. Cell nuclei were stained with DAPI. Images of each section were captured using a fluorescence microscope (Leica) by investigators blinded to the experimental groups.
To analyze microglial morphology, images were captured using a confocal microscope (LSM800, Zeiss) with 20× magnification. ImageJ (Loci, Madison, WI, USA) was used to analyze the shape of two-dimensional somatic projections in confocal images of Iba-1-immunostained microglia based on maximum length (L) and projection area (A)[56].
Statistical analysis
Differences in plaque/cell counts, areas of staining, and nest construction scores between the vehicle- and zerumbone-treated groups were analyzed by the Mann-Whitney U test or the Kruskal-Wallis test if more than two groups are compared, using Graph Pad Prism 5.0 software (San Diego, CA, USA). The data are represented as median and interquartile ranges for non-parametric statistics. For all statistical analyses, a p value < 0.05 was considered statistically significant.