Tissue culture
SH-SY5Y cell were acquired from ATCC and maintained in DMEM/F12 (1:1) with penicillin (100 U/mL), streptomycin (100 μg/mL) and 10% FBS. At 90% confluency, monolayer was washed twice with PBS, and cells chemically detached with 0.05% trypsin for 2 min. After quenching with complete media, cells were pelleted by centrifugation at 800 rpm for 5 minutes, washed twice with PBS, resuspended in complete medium and 3x104 to 106 cells seeded in 10cm tissue culture dishes. Medium was changed every other day. SH-SY5Y cells were differentiated into dopaminergic neuron-like cells with (10 μM) retinoic acid in DMEM (1%FBS) for 5 days. Upon differentiation, cell adherence was confirmed under the microscope, and leftover suspension cells were removed by gentle washing.
Pyroptosis assay
SH-SY5Y cells were seeded in 6-well plates at 106 cells/well for 24 hours and then treated with increasing MPP+ concentrations for 24 hours. Cells were the gently washed with PBS and chemically detached with 0.05% trypsin/EDTA. After detachment, trypsin was quenched with complete media, cells pelleted by centrifugation and caspase activity detected with FAM-FLICA capase-1 assay kit (ImmunoChemistry Technologies, LLC, Bloomington, MN, USA) according to manufacturer’s recommendations. In a nutshell, cells were stained were incubated with FLICA (1:30) for 1 hour at 37°C protected from light. Cells were then by washed with 5 volumes of 1X apoptosis wash buffer, pelleted by centrifugation, resuspended in 1X apoptosis wash buffer with 5µL of PI and incubated for 10 minutes 37°C protected from light. Data was acquired with Beckman DxFlex flow cytometer (Beckman, USA) and analyzed with CytExpert (Beckman Coulter Inc, CA, USA). Single stain controls were used to calculate compensation. PI positive cells were detected according to the operation procedure of PI staining kit (KeyGEN Biotech, NanJing, China)
Total protein extraction
Cells were seeded in 6-well plates at 106 cells/well and treated with 1mM MPP+. When designated, cells were also treated with mir590-3p mimic or inhibitor and corresponding negative controls. At designated timepoints, cells were washed with pre-cooled PBS and lysed with 1 ml of RIPA buffer supplemented with PMSF for each 100 µL of sample. After full lysis, samples were centrifuged at 12,000 g, 4 ℃ for 5 min, the supernatant immediately transferred to a clean pre-cooled tube and stored at -80 ℃ for later analysis. Total protein content was quantified by BCA method, 25µg added to 5×loading buffer and boiled for 10 minutes in water bath for denaturing. Samples were stored at -20 ℃ until western blot analysis when needed.
Immunoprecipitation (Co-IP) assay
Protein extracts were prepared as described above. Protein A/G-agarose microspheres were washed twice with PBS and adjusted to a 50% agarose microspheres concentration in PBS. In detail, 100 μL of 50% of Protein A/G-agarose were added to 1mL of sample and incubated in a horizontal shaker at 4°C for 10 min to remove unspecific binding. Samples were then centrifuge at 14000 g for 15 minutes at 4°C, and the supernatant transferred to a clean centrifuge tube. Total protein was estimated by BCA method, and adjusted to 3 μg/μL with PBS. Immunoprecipitation microspheres were prepared in 500μL with pre-titrated target antibody and 1 volume of bead mixed with 7 volumes of sample. Samples were incubated overnight at 4℃ with gentle shaking, centrifuged at 14000g for 5s, the precipitate collected, and washed 3 times with pre-cooled washing buffer (800μL per wash). The pellet was resuspended in a suitable volume of loading buffer and the supernatant collected for further downstream SDS-PAGE western-blot analysis.
Western blotting
Denatured samples were loaded in 10% or 12% resolving and 5% stacking SDS-PAGE gels prepared in house. Denatured samples were separated by electrophoresis in the MINI-PTET (BioRad, California, USA) system at 120 V for 5 min (stacking) and 80 V (resolving) for about 30 min with pre-chilled 1× electrophoresis buffer. 5 µL of 3-color pre-stained protein ladder (Green, BioReseach LLC, LA, USA) was used as standard for protein size estimation. For transfer, PVDF membrane was pre-activated in methanol for 1 min, and then immersed in the transfer buffer for 15 minutes. Samples were transferred with semi-dry blot apparatus (BioRad, California, USA). Transfer efficiency was confirmed by Ponceau S staining. For specific protein expression, membranes were incubated with primary antibody, at pre-titrated concentrations (Table 1), in Tris buffered saline/0.05%Tween20 (TBST) and self-sealing bags and incubated overnight at 4℃. Membranes were then washed three time with TBST for 10 min with gentle rocking, and antibody binding detected with appropriate HRP-conjugated secondary antibody at pre-titrated concentrations in Ziplock bags for 1 hour at room temperature. Membranes were washed again 3 times with TBST. Membranes were developed with ECL Luminescent Solution (Thermo Fisher Scientific, Pittsburgh, PA, USA) for 5 min according to manufactures’ instructions. Membranes were imaged with Tanon 6600 Luminescent imaging workstation (Tanon, Shanghai, China) and relative protein expression levels quantified with Image Pro Plus 6.0 software (Media Cybernetics, USA). The expression level was calculated as [target protein gray value]/[internal reference protein gray value].
RNA extraction
SH-SY5Y cells were seeded in 6-well plates at 106 cells/well and treated with MPP+ as described above. At 90% confluency or designated timepoints cells were chemically detached with trypsin, lysed with RNAiso plus Trizol, at room temperature for 10min and RNA extracted according to manufacturers’ recommendations. In a nutshell, 1/5 volume of chloroform was added, samples were shaken and let stand at room temperature for 5min, followed by 15 minutes centrifugation at 12000g 4°C. Supernatants were transferred to a clean centrifuge tube, 1 volume of isopropanol added, and the samples inverted and mixed vigorously. After 10 minutes incubation on ice, samples were centrifuged at 12000g, 4°C for 10min and the supernatant discarded. RNA was washed with 1ml of 75% ethanol, air-dried (5-10 min) and resuspended in 20 µl of RNase-free water. RNA content, purity and quality were estimated with Nanodrop 2000 (Thermo fisher, USA) (2µL of sample).
MicroRNA extraction
SH-SY5Y cells were seeded in 6-well plates at 106 cells/well and treated with MPP+ as described above. At 90% confluency (unless otherwise stated), cells were chemically detached with trypsin, pelleted by centrifugation and resuspended in 100μL of PBS. MiRNA was extracted with tissue/cell miRNA extraction kit (Haigene, Harbin, China) according to manufacturers’ recommendations. In a nutshell, 300 μL of miRNA ReagentA were added, the sample mixed by inversion and incubated at room temperature for 5 min. After lysis, 250 μL of miRNA ReagentB was added, again mixed by inversion and centrifuged at 13000rpm for 5 min. The supernatant was transferred to a clean 1.5 ml tube, 200 μL of absolute ethanol added, mixed vigorously, and incubated at room temperature for 5 min with shaking. After centrifugation at 13000 rpm for 10 min, isopropanol was added (3:7 volume ratio), the sample inverted several times and loaded into the miRNA adsorption column. Column was washed twice with 75% absolute ethanol, dried for 10 min and eluted with 30 μL RnaseFree TE Buffer to a new clean tube by centrifugation at 13000rpm for 2 min.
qRT-PCR
First strand cDNA reverse transcription from mRNA was performed with iScript cDNA synthesis Kit (BioRad, USA) according to manufacturers’ recommendations in 20μL reactions with 2μL of total RNA. The reaction was performed at 25°C for 5 min, 42°C for 30 min, and 85°C for 5 min, and cDNA stored at -70°C. qRT-PCR was performed with Sofast EvaGreen Supermix system (BioRad, USA) in 20μL reactions with 1μL cDNA template according to manufacturer’s recommendations in a ABI 7500 real-time quantitative PCR instrument (American Applied Biosystems, USA).
First strand cDNA reverse transcription from miR and lncRNA was performed with one-step miR RT kit (Takara, Japan) in 20μL reactions with 4μL of RNA template according to manufacturer’s recommendations. The reaction was performed for 60 minutes at 37°C, followed by 5 minutes at 95°C. qRT-PCR was performed with cDNA SYBR Green miRNA fluorescence quantitative PCR kit (Haigene, Harbin, China) in 20μL reactions with 2.5μL template cDNA. qRT-PCR was run in ABI 7500 real-time quantitative PCR instrument (American Applied Biosystems, USA). qRT-PCR protocols are shown in table 2. Gene-target specific primers are shown in table 3. Fold change differences in gene expression were calculated by 2-ΔΔCt method.
Lentiviral production
RNAi sequences were cloned into GV493 plasmid and expanded in E.coli DH5α cells in house (Fig. S1). LncZFAS1 RNA sequence was cloned into pcDNA3.1 (Fig. S2). Lentiviral packaging was performed in 293T cells seeded at 5×106 cells/15mL in T75 flask in DMEM medium with 10% FBS for 24 before transfection. At 70-80% confluency, cells were washed with PBS, 1 volume of serum-free medium added and incubated for 2 hours incubation at 37°C 5% CO2 . Transfection mixture was prepared with 20 μL of vector plasmid, mixed with 15 μL pHelper1.0 vector plasmid, 10 μL pHelper 2.0 vector plasmid, and GK transfection reagent (Genechem, Shanghai, China), in a total 1mL volume reaction, and incubated at room temperature for 15 min. The transfection mixture was slowly added to the 293T cell culture (in serum-free medium) with gentle rocking, and incubated at 37°C, 5% CO2 for 6 hours. Cells were gently washed with warm PBS, 20mL of complete medium (with 10% FBS) added and incubated at 37°C and 5% CO2 for 48 h. Supernatants were collected 48 h after transfection, centrifuged at 4000 g for 10 min at 4°C to remove cell debris and transferred to 40 ml ultra-centrifuge tubes through 0.45 μm filter. Lentiviral particles were pelleted by ultracentrifugation at 25000 rpm, 4°C for 2 h, media supernatant was discarded, lentiviral particles resuspended in residual volume and transferred to clean tube. Samples were centrifuged one last time, at 10,000 rpm for 5 minutes and the supernatant containing lentiviral particles transferred to a clean tube. Lentivirus titer was detected in 293T adherent cells. Cells were seeded in 96 well-plates at 4×104 cells/well, in 100 μL medium and incubated for 24 hours. Lentiviral preps were serial diluted (1/10) in serum free media (10 to 10-10), added to T293 cells and incubated at 37°C and 5% CO2 for 24 hours. 100 μL of complete medium was added and lentiviral titer measured after 4 days by fluorescence expression. Lentiviral titer was determined as transducing units (TU/ml) calculated as
Lentivirus transfection
SH-SY5Y cells were seeded in 24-well plates at 0.5×105 cells/well and incubated at 37°C, 5% CO2 overnight. Prior to transfection, cells were washed with PBS, and 500μL of 0.8μg/mL Polybrene in serum-free medium with 20μL lentivirus at pre-titrated MOI of 5 were added. Cells were incubated overnight at 37°C and 5% CO2, the medium removed and replaced for 1ml of complete medium, and incubated at 37°C and 5% CO2. Transfected cells were expanded and subcultured at a 1:3 ratio. 48 hours after subculture, cells were seeded in a Petri dishes 200 μg/mL Puromycin selection medium, changed every 3/4 days, until clonal cell clusters appeared. Single cell clones were digested, transferred to 6-well plates, expanded, frozen and stored in liquid nitrogen. Transfection efficiency was confirmed by WB and qRT-PCR (Fig. S3)
Luciferase reporter assay (pMIR-REPORT fluorescent reporter gene)
The 3'UTR full length of the pre-selected target gene MIB1 was identified based on TargetScan Human 7.2 website (http:www.targetscan.org/vert_72/). Primer 5 (Premier, California) was used to design primers (Table 3) with the 3'UTR fragment of the MIB1 gene containing the hsa-miR-590-3p binding site. The MIB1 sequence (with 3'UTR) was then cloned in house into the pmiR-report plasmid (Ambion, Texas, USA, Fig. S4) and expanded in E. coli DH5α cells. First strand cDNA reverse transcription from mRNA was performed with iScript cDNA synthesis Kit (BioRad, USA) as described above. Site directed mutagenesis was performed with QuickMutagenesis Kit (Thermo Fisher Scientific, Pittsburgh, PA, USA) according to manufacturer’s recommendations. SH-SY5Y cells at 50% confluency, were then transfected in 96-well plates with Lipofectamine 3000 system (Thermo Fisher Scientific, Pittsburgh, PA, USA) according to manufacturer’s recommendations. Luciferase double reporter gene expression was detected with dual luciferase reporter gene detection kit (KeyGEN Biotech, NanJing, China) according to manufacturer’s recommendations. Briefly, after 36-48h of plasmid co-transfection, medium was discarded, and the cells washed with 100μL 1X PBS. 50 μL of 1X PLB was added to each well, and the plate incubated for 20-30 min with shaking to ensure lysis. 10μL of the supernatant were added to 96-well white opaque microtiter plate (Thermo fisher, USA), followed by 100μL of pre-mixed Luciferase Assay Reagent II. Plates were read in a dark chamber with a Berthold LB941 microplate multi-functional microplate reader (Berthold, Germany) 2s after starting reaction to detect the luciferase activity (RLU1). 100 μL of pre-mixed Stop&Glo Reagent were then added to each well to detect the intensity of the luciferase reaction in the internal reference control (RLU2). Gene-specific luciferase activity was calculated as RLU1/RLU2.
miR590-3p mimic and inhibition assay
hsa-miR-590-3p mimics (Sequence: UAAUUUAUGUAUAAGCUAGU), mimic NC (sequence: UUGUACUACACAAAAGUACUG), hsa-miR-590-3p inhibitor (sequence: ACUAGCUUAUA CAUAAAAUUA), Inhibitor-NC (sequence: CAGUACUUUUGUGUAGUACAA) particles were purchased from Nanjing Darn Pharmaceutical Technology Co., Ltd (Nanjing, China). SH-SY5Y cells at 50% confluency were transfected in 6-well plates with Lipofectamine RNAiMAX (Thermo fisher, USA). In detail Lipofectamine RNAiMAX (6μL), 20pmol RNAi were mixed in 200μL OPTI-MEM medium and incubated at room temperature for 20 minutes prior to transfection. SH-SY5Y cells were gently washed with 1×PBS three times, 2 mL of OPTI-MEM medium added to each well, and acclimated to 37 ℃, 5% CO2. Transfection reagent mixture was added to the culture, with gentle shaking and incubated at 37 ℃, 5% CO2 for 48 hours.
Fluorescent in situ hybridization (FISH) and confocal microscopy
FISH staining kit was purchased from RiboBio (Guangzhou, China). Digoxin labeled probes (TACTTCCAACACCCGCATTCATC) were acquire from RiboBio (Guangzhou, China). 2X105 cells SH-SY5Y cells were seeded in 24-well microscopy slides (Thermo Fisher Scientific, Pittsburgh, PA, USA). After treatment, cells were washed with pre-cooled PBS, and fixed with 4% RNase-free Paraformaldehyde at room temperature for 15 minutes. After washing with PBS 3 times for 5 min, cells were permeabilized with 0.2-0.5% Triton X-100 for 5 minutes at room temperature. Cells were washed again with PBS (3×5min) and dehydrated (80%-90%-100% alcohol gradient for 2-3min each). The hybridization solution was prepared in house with Formamide mixed with 2X saline-sodium citrate (SSC) in a 1:1 volume at room temperature for 10 minutes. Cells were washed again with PBS, 25µl of hybridization solution added to each well, and incubated in the hybridization furnace at 50℃ for 4-8h. 60 µl of denaturing hybridization solution containing probe were then added to each well and incubated overnight in the hybridization furnace at 50℃. Cells were wash with 0.1×SSC with 0.1% SDS and 50% formamide for 30 mins. Samples were then blocked with 90 µl 20% sheep serum at room temperature for 1h. Hybridization was detected with 60 µl anti-digoxin antibody, prepared 1/2500 in 10% sheep serum and incubated overnight at 4°C. After washing with PBS, samples were counterstained with add 10 µl of 200 mg/ml DAPI at room temperature for 10 min. Cells were washed one more time with PBS, mounted with 10µl of anti-quenching mounting agent, seal with rubber cement, and imaged with Zeiss LSM laser confocal microscope (Zeiss, Germany).
Statistics and data analysis
All data are expressed as means ± SD. One-way ANOVA and non-parametric Kurskal-Wallis test are used for statistical differences between groups. P-values less than 0.05 are considered significant differences. Data was analysed with Graphpad 6.0 (San Diengo, CA, USA).