Effects of Isochronal Induced Feed Restriction With Transition Period On mRNA Abundance of The Hepatic Genes Related to Lipid Metabolism in Fat-Tailed Ewes

doi:10.21203/rs.3.rs-774057/v1

The process of fat mobilization during the transition period requires deep re-orchestration of the energy indices, and understanding its mechanism has generated considerable interest among the TP-related studies. The present study aims to validate the effect of feed restriction and TP on the mRNA abundance of hepatic genes related to fat metabolism in fat-tailed sheep. Twenty pregnant ewes with the age of 40.8 ± 6.2 (mean ± standard error) month were randomly assigned to Control (n=10) or Restriction (n=10), and investigated from week -5 to 5 relative to parturition. Control animals received 100% DM during the trial. Restriction animals received 100% DM through weeks -5, -1, 1 and 5 and were fed with 50, 65, and 80% DM in the weeks -4, -3, -2 and 2,3, and 4, respectively. On the third week of experiment (65%) during both pre and post-partum, the hepatic tissue was biopsied, and the mRNA load of the fatty acid synthase, acetyl-CoA carboxylase, carnitine palmitoyltransferase (CPT) 1, CPT2, and acyl-CoA synthase long-chain family member-1 genes was quantified by the TaqMan qPCR technique. Data were analyzed using the Mixed Model procedure of SAS. The mRNA abundance of the target genes was not influenced by feed restriction, during the pre and postpartum periods. Parturition suppressed the mRNA abundance of target genes in both groups. It can be concluded that the liver of the fat-tailed sheep would have a higher capacity for the metabolism of free fatty acids mobilization during the feed insufficiency and the challenging period of transition.

Animal Science

fat-tailed ewe

hepatic gene

lipogenesis

lipolysis

transition period

The change of physiological status from gestation to lactation in the transition animals requires ubiquitous alteration due to extensive metabolical and hormonal shifts. Through the transition period (TP), the amount of energy and protein requirements for fetal growth, maintenance, and milk production increases and intensifies so promptly that the feed intake could not meet that demand, and the body begins to mobilize the reserved fats, proteins, and minerals to compensate the scarcity (Drackley et al., 2001; van Dorland et al., 2009; Zarrin et al., 2017). Some livestock species would be capable of managing such perplexing physiological period, but others, chiefly high-yielding dairy cattle, and multifetal sheep, could not control the negative energy balance (NEB), which would cost them different ranges of metabolic disorders.

According to the literature, the transition ruminants are frequently at NEB due to lessened feed intake and higher energy requirements (Zarrin et al., 2017; Hernández-Castellano et al., 2020; Zarrin et al., 2021). Negative energy balance during the TP is a significant determinant to demonstrate the occurrence and exacerbation of metabolic disorders mainly due to increased concentration of the ketone bodies in sheep (Van Saun, 2000; Lacetera et al., 2001). By re-orchestrating the hormones and enzymes of the energy-regulatory processes, these circumstances, let out part of the body reservoirs for energy supply, which in turn the mobilized metabolites influence the homeostatic array, too (Drackley et al., 1999; van Dorland et al., 2009; Zarrin et al., 2017). During late pregnancy and by embryonic growth, the needs of ewes would be maximized, which levels up the lipid metabolism (Lacetera et al., 2001). Therefore, lipolysis is an essential energy source for ruminants, especially at the end of pregnancy (Zhong et al., 2015). The published data have revealed that NEB causes significant fluctuations in some circulatory parameters such as free fatty acids (FFA), beta-hydroxybutyrate (BHB), and hormones such as insulin, growth hormone, and prolactin in ruminants (van Dorland et al., 2009; Zarrin et al., 2017; Zarrin et al., 2021). The same results also substantiated the severity of changes in the animals with feed restriction (Zarrin et al., 2021).

The liver is a vital organ in regulating metabolism and coordinating nutrient mobilization and metabolism to meet pregnancy and lactation needs (Reynolds et al., 2003). Hence hepatocytes are challenged by mobilization of fatty acids due to the need for energy supply and compensation during TP, as attestations by the higher mRNA abundance of most lipid metabolism-related genes in such cells (Loor et al., 2005). Over and above the crucial role of adipose tissue in ruminants concerning de novo fatty acids synthesis, the liver plays a pivotal role in fat anabolism, too (Bauchart et al., 1990). Hepatocytes have been considered the epicenter of many lipids and lipoprotein metabolic activities such as absorption, oxidation, metabolic transformations of FFA, synthesis of cholesterol and phospholipids, and production and secretion of different classes of lipoproteins (Bauchart et al., 1990).

Our knowledge of the mechanism of hepatic tissue function in fat-tailed sheep during TP is based mainly on very limited data. The aim of the present study was thus understanding the influence of TP concurrently with feed restriction on the mRNA abundance of hepatic genes regulating lipolysis and lipogenesis of the fat-tailed ewes before and after lambing. Within the framework of these criteria, the effects of parturition, feed scarcity, and the interactions of these two phenomena were scrutinized.

Animals and management: The present study was conducted on the research farm of Yasouj University (NareGhah, Yasouj, Iran). All the principles of housing, handling, and sampling related to the trial were based on bioethics and observance regulations of animal rights (Yasouj University, No. 19003-960441008). Before the animal experimentation, the animals were checked for their health and showed no signs of disease or disorder and were then monitored by a veterinarian on a regular basis throughout the experimental period. The details of the experimental animals, ration, and treatment regimens have been reported previously (Zarrin et al., 2021). In brief, 20 multiparous ewes (Lori-Bakhtiari n = 10 and Turkish-Qashqai n = 10) with an average age of 40.8 ± 6.2 (mean ± standard error) month and live weight of 56.0 ± 1.8 kg were picked and randomly allotted to one of the two groups of control (n = 10; Control) and feed restriction (n = 10; Restriction).

The animals were housed individually in 1.2 × 1.0 m cages with separate drinkers and feeders and free access to water and mineral blocks during the experimental trial. The trial was 10 wk long and in pre and postpartum periods (five wk before and five wk after parturition) plus a 14-day adaptation period before the trial. In order to sanitize and sterilize the cages and provide sunlight and walking chance, the ewes were passed on to the yard after the morning feeding, twice a week for 3 hours. The animals were transferred three days before parturition to a separate 3.0 × 2.0 m² chamber, with the floor covered with clean straw. The ewes were fed with a total mixed ration, balanced according to the recommendations of NRC (2007) for dry, single-bearing ewes with a live weight of 55 kg twice a day at 0800 and 1700. The control animals had free access to the ration during the trial. The animals in the Restriction group received 100% DM during the − 5, -1, 1, and 5 weeks. They received 50, 65, and 80% DM in the weeks − 4, -3, and − 2 during prepartum and 2, 3, and 4 during postpartum, respectively.

Biopsy of the liver tissue: The liver biopsies were collected after local anesthesia, using 10 ml of 2% lidocaine (Iran Hormone Company, Tehran, Iran) with a biopsy needle (Tru-Cut, 14G 120 mm, Provet AG, Lyssach, Switzerland) on the last day of both − 3 and 3 weeks (before and after parturition; 65% feed restriction) from ewes of the Control and Restriction based on the modified Ferreira et al. (1996) method. The samples were then soaked directly into RNA stabilizers (RNAlater; Ambion, Applied Biosystems, Austin, TX, USA) at 5°C for 24 hours and were then frozen at -40°C until RNA extraction.

RNA extraction, cDNA synthesis, and gene analysis: RNAs of the samples were first extracted using TRIzol solution (Invitrogen, Carlsbad, CA, USA) based on the manufacturer's instructions. The extracted RNA was quantified using an ND-100 UV-Vis nanodrop spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA) and qualified by agarose gel electrophoresis. All samples were adjusted to a concentration of 2 ng / µl and enzymatically treated before cDNA synthesis to remove the gDNA (Ambion, Foster City, CA, USA). Following RNA preparation, the cDNA was synthesized using high-performance cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). The mRNA abundance of the genes was evaluated using the TaqMan qPCR technique. ABI 7500 fast (Applied Biosystems, ABI 7500 fast, CA, USA) was used to determine the relative abundance of the mRNA. The primer characteristics of the reference genes (18s and glyceraldehyde 3-phosphate dehydrogenase; GAPDH) and target genes are shown in Table 1. The amount of Threshold Cycle (CT) obtained for the target genes was corrected based on the mean CT of the reference genes (∆CT). The differences in mRNA abundance of the target genes based on the treatments (Control and Restriction) and parturition (before and after) (∆∆Ct), as well as the rate of the changes for each stage, were obtained based on the following equations

∆CT = CT [Target gene] - CT [Reference gene]

∆∆CT = ∆CT [Restriction] - ∆CT [Control]

∆∆CT = ∆CT [Postpartum] - ∆CT [Prepartum]

Fold Change = 2^ - (∆∆CT)

Table 1

Taqman primers and probes of the desired genes
Gene	Orientation	Sequence 5´to 3´	TM ºC	Product size
Reference genes
18S	Forward	GGAACTGAGGCCATGATTAAGA	56.34	177 bp
	Reverse	TCGGAACTACGACGGTATCT	55.70
	Probe	AAGACGGACCAGAGCGAAAGCAT	63.32
GAPDH	Forward	CCCTTCATTGACCTTCACTACA	56.21	236 bp
	Reverse	GTTCCATCTCCCACACTTACTC	56.66
	Probe	CACAGTCAAGGCAGAGAACGGGAA	63.78
FA and cholesterol synthesis-related genes
FAS	Forward	ACAACTGCACACCAGAGGTA	56.85	200 bp
	Reverse	CTGTGCCCTTGAAGCACTTT	56.97
	Probe	TGGTGTCCTGCCCTCGCCTCC	66.78
ACC	Forward	GAGTAAGCTCTCCACCCTTTAAC	57.23	169 bp
	Reverse	TGAGACAGTTCACCTGGATTTC	56.50
	Probe	ATAGTGGAGATGGGCAGGTTGTGG	63.20
FA oxidation-related genes
CPT1	Forward	TGGGATTTGGAGGAGTGAAAG	55.81	171 bp
	Reverse	GAGGAACCCACTGTTGTCATAA	56.49
	Probe	TGCTCTGTGAGCATGCCTGTTTCT	63.82
CPTII	Forward	CTGTCAAATATATCGCACGCA	55.20	220 bp
	Reverse	ACAGCATTAAGGCAATTCCAG	55.12
	Probe	ATTAATTACTTGGCTATGCAGT	52.07
ACSL1	Forward	ATTACCGATGCTAAGTCCAAGT	55.74	187 bp
	Reverse	TTAGCCGTACGTTGCAACGTA	58.64
	Probe	AGTTCAATCCCGAATCGCGAA	58.69
FAS = Fatty acid synthase; ACC = acetyl-CoA carboxylase; CPT I = Carnitine palmitoyltransferaseI; CPT II = Carnitine palmitoyltransferaseII; ACSL1 = acyl-coA synthasse long chain family member 1.

Statistical analysis: Natural data distribution was performed using the SAS (Version 9.4, SAS Institute Inc., Cary, NC, USA) method. The results obtained for CT were evaluated using the Mixed Model procedure of SAS statistical software. In the model, feed treatments (Control and Restriction), time (before and after parturition), and interaction (treatment × time) were considered as fixed effects. Breed (Lori-Bakhtiari and Turki-Qashqai) was determined as a random effect and animal as a repeat. The data obtained for ∆∆CT and the fold change value were evaluated using the GLM procedure of SAS statistical software. Mean differences were compared using the Tukey’s Kramer test. The data were presented as (Mean ± SEM), and P ≤ 0.05 was considered significant. The Sigmaplot software (Version 14, Systat Software GmbH, Erkrath, Germany) was applied to create the charts.

The mRNA abundance (ΔCT) of the reference and target genes: Comparison of delta CTs of the 18S and GAPDH and their average values for both feeding treatments during the pre and postpartum periods are presented in Figs. 1a-1c. As predicted, neither the treatments nor the time altered the mRNA abundance of these two genes and their mean values.

As given in Fig. 2a, the fatty acid synthase gene (FAS) uncovered no consequence from Restriction in both pre and postpartum phases, and the mRNA abundance did not change between the feeding groups in both experimental sessions. However, the results revealed the negative effect of parturition on the mRNA plentitude of this gene (P < 0.001).

As illustrated by Fig. 2b, the feed restriction before and after lambing did not impact the Acetyl-CoA carboxylase gene (ACC), and its mRNA abundance was statistically similar in both groups. Parturition repressed the mRNA expression of this gene and reduced it in both treatment groups compared to prepartum (P < 0.001).

Although feed restriction had no detectable effect on the carnitine palmitoyltransferase I (CPTI) mRNA abundance, parturition attenuated the mRNA just in the animals of the Restriction group compared to the pre-partum (Fig. 3a; P < 0.01).

The mRNA abundance of carnitine palmitoyltransferase II (CPTII) is unlikely to have been affected by feed restriction and remained unchanged in both pre and postpartum periods compared to the Control one. However, mRNA expression showed a significant decrease in both feeding groups than the prepartum (Fig. 3b; P < 0.001).

The acyl-CoA Synthetase Long-Chain Family Member 1 (ACSL1) gene in the liver exposed no affectability from Restriction before and after parturition, although the downregulatory effect of parturition decreased the mRNA abundance of this gene in both feeding groups compared to prepartum (Fig. 3c; P < 0.001).

Change rate (ΔΔCT) of the reference and target genes: The results of the observed changes in the mRNA abundance of the reference and target genes throughout the pre and postpartum periods are reported in Fig. 4. Based upon the presented figure, none of the detected genes have been forced by treatment, and the slight numerical differences were not significant (Fig. 4a).

Figure 4b shows the observed alterations in the mRNA abundance of the picked genes in the Control and Restriction groups before and after lambing. As shown, lambing induced a significant reduction in mRNA expression in most of the target genes in the Control and Restriction groups except for the CPTI in the Control group (P < 0.05). The interaction impact was also measured, and it was not significant.

Fold change of the reference and target genes: Fold change of the reference and target genes during pre and postpartum period demonstrated no signs of statistical differences resulting from treatment strategies, and this parameter remained constant between both feeding groups within pre and postpartum trials for all the chosen genes (Fig. 5a). Furthermore, the fold change of the investigated genes during postpartum compared to prepartum in both treatment regimens did not contradict significantly (Fig. 5b). The obtained results indicated significant change of fold changes of the target genes for both treatment and time, and they were different from 0 (P < 0.05; Fig. 5a, b)

To the authors' best knowledge, the present study is the first study to investigate the simultaneous effect of the TP and induced feed restriction on the mRNA abundance of the hepatic genes related to lipogenesis and fat oxidationin fat-tailed sheep. According to the literature, energy precursors such as BHB and FFA are affected by TP plus feed restriction, and consequently, changing the hormonal array of milk biosynthesis could also affect animal performance (Zarrin et al., 2021). Investigating the mRNA abundance of the hepatic genes related to lipogenesis (FAS, ACC) before and after lambing proved that feed restriction at the time of sampling had no effect on these genes and was almost identical in both treatment groups.

The ACC, codenamed acetyl-CoA carboxylase, involves in the biosynthesis of long-chain fatty acids. This enzyme is responsible for catalyzing ATP-dependent carboxylation, which converts acetyl-CoA to malonyl-CoA. Malonyl-CoA is recognized as the raw material for synthesizing palmitic acid as the building block in the biosynthesis of long-chain fatty acids (Smit et al., 2003). Fatty acid synthase is an enzyme encoded by FAS. This enzyme catalyzes the synthesis of palmitate from malonyl-CoA and acetyl-CoA by the attendance of NADPH and ultimately produces long-chain saturated fatty acids (Leonard et al., 2004). Contrary to the results obtained in this study, Dervishi et al. (2011) stated that insufficient access to feed suppressed the activity of essential enzymes such as ACC and FAS in lipid syntheses by reducing their mRNA abundance. Zakariapourbahnamiri et al. (2018a, b) have also suggested that feed restriction reduces the mRNA load of crucial enzymes such as ACC and FAS, associated with lipid biosynthesis, in the subcutaneous adipose tissue in lambs.

The current study showed that the synthesis of fatty acids and lipogenesis was affected by lambing and significantly downregulated the studied genes compared to the prepartum period. In a study on subcutaneous adipose tissue genes in bovines during the TP, it has been reported that the mRNA abundance of the ACC and FAS genes in the first postpartum day was significantly lower compared to the prepartum period (Sadri et al., 2010). Sadri et al. (2011) described that the non-esterified fatty acid (NEFA) concentration on the first postpartum day was higher than those at other sampling times (week 8 before calving and week 5 after calving) in cattle. The same researchers also reported that the mRNA abundance of the ACSL, unlike the FAS and ACC genes, was not affected and showed no significant change (Sadri et al., 2011). Lack of effectiveness of feed restriction on the mRNA load of the desired genes before and after lambing in the current research might be partially linked to the energy level, which its indices did not show significant differences between the sampling days (Zarrin et al., 2021). In addition, the capacity of fat-tailed ewes to adapt to NEB requirements can also be acknowledged as one of the advantages of such breeds. Downregulation in the lipogenesis-related genes in this study following lambing may be due to NEB elongation during this session. Although there is still a lot more to be known, it has been suggested that decreased mRNA level of the FAS and ACC genes in the postpartum period has reduced the de novo synthesis of fatty acids, indicating decreased lipogenesis during the TP (Doepel et al., 2002; Sadri et al., 2011).

The mRNA quantity of both CPTI and CPTII genes was not affected by feed restriction, while lambing suppressed these two genes in the present study. Carnitine palmitoyltransferase1 is encoded by the CPTI B gene and counted as part of the mitochondrial transport system and a key enzyme controlling the beta-oxidation of long-chain fatty acids. This enzyme induces the oxidation of fatty acids in mitochondria (Bartelds et al., 2004). The CPT1 gene is a crucial regulator of fatty acid metabolism and is fundamental in transporting the fatty acyl-CoA into mitochondria (McGarry and Brown, 1997). The critical role of CPT enzymes in the metabolism of fatty acids and especially the transfer of fatty acyl-CoA into the mitochondria can also explain the reduction of mRNA abundance of other genes involved in beta-oxidation and fatty acid synthesis (van Dorland et al., 2009). In other words, a decrease in the mRNA concentration of these genes might lead to a reduction in the quantity of the mRNA of other understudied genes.

Despite the current results, Loor et al. (2005) has reported an increase in the CPTI mRNA abundance on the first day after calving in transition cows. The inconsistency between the current study and the study by Loor et al. (2005) might be described by several pieces of evidence, including different sampling times (one day after delivery and three weeks after delivery), different body reserves, and different species. On the other hand, based upon the preliminary data (Zarrin et al., 2021), the concentration of fatty acids in postpartum at the time of sampling might not be high enough to enhance the changes in the mRNA abundance of the selected genes. Based on the comprehensive studies conducted by different researchers, the load of different genes related to metabolism should be considered all in one and their associations together. It has been substantiated that the activity of some genes is relevant to the activity of other ones (van Dorland et al., 2009). These researchers investigated the extensive correlations of various genes involved in energy metabolism pathways, especially gluconeogenesis and fat metabolism in cows with high BHB and NEFA levels. They also showed that various genes involved in these metabolic processes positively correlate with the genes, metabolites, and hormones altered by changing the BHB and NEFA concentrations under different conditions and negative correlations with other genes. Among the positive correlations of the studied genes, the correlation of the ACSL with CPTI and CPTII genes at different times of the TP could be pointed out (van Dorland et al., 2009).

One of the most critical criteria in measuring lipogenesis is a reconstitution of triglycerides from fatty acids, in which the ACSL enzyme plays a pivotal role. The enzyme converts long-chain fatty acids to fatty acyl-CoA esters, which ultimately play an essential role in lipid biosynthesis. The ACSL gene catalyzes the first step in the fatty acid metabolism, which is the activation of fatty acids to acyl CoA in the cytosol (Voet and Voet. 2004). There was no difference in the mRNA level of ASCL before and after lambing between the Restriction and Control groups in the present study. However, the mRNA content of the ASCL gene in the postpartum period showed a significant reduction compared to the prepartum duration.

It had been hypothesized that the increase in the concentration of the FFA and BHB concentrations in the Restriction group before lambing would boost the ACSL gene, and its mRNA abundance would be higher than the Control, but the observation did not reinforce the assumption. The findings on the ACSL gene in the present study corroborate the research results on dairy cattle with NEB and high circulatory BHB in the fourth week of lactation (van Dorland et al., 2009). Lack of significant differences between the circulatory energy metabolism indices, including FFA, glucose, and BHB concentrations (Zarrin et al., 2021), between the treatment modalities during the weeks of liver biopsy lead the authors to expect untouched ASCL after parturition. The concentration of such metabolites declined after lambing compared to the prepartum period. Differences between the treatments might be attributed to the metabolic status of the animals at the time of sampling, which in this case, lack of difference could be explained as equilibria in a state of energy that the animals necessitated no beta-oxidation of long-chain fatty acids (C18: 0 to C12: 0) to cover the NEB (Loor et al., 2005; van Dorland et al., 2009). However, the precise mechanism remains unclear that offers opportunities for further study. Since the mRNA abundance of the desired genes was not affected by feed restriction, it can be inferred that fat-tailed ewes have evolved to cope with the period of feed scarcity, relying on deposited fat around the tail-head, phenomenal fat metabolism, and liver capacity.

It would be reasonable to conclude that the force of lambing on mRNA abundance of the hepatic genes during prepartum can be attributed to the augmented demands of energy as an outgrowth of fetal growth during the last months of pregnancy. Although we should stress that these results are only provisional, the reduction in mRNA plentitude of the FAS, ACC, CPTI, CPTII, and ACSL1 genes compared to the prepartum period probably indicates the transfer of colostrum and milk compounds, including fatty acids mobilized from the dam's circulatory system to the udder tissue. The findings presented in this study provide a starting point for further examination regarding the evolutionary benefit of fat-tail, particularly in tropical regions and impoverished pastures. Moreover, if the results are reproducible in other studies, a deeper understating of the mechanism behind fat metabolism during the TP might be attainable in their light.

Author Contributions: Conceptualization, M.Z. and A. A; methodology, M.Z., Z.H., and A.A.; software, M.Z. and Z.H.; validation, M.Z. and A. A; formal analysis, M.Z and A.A; in-vestigation, M.M. and A.O.; resources, A.A.; data curation, M.Z.; writing—original draft prepara-tion, Z.H and M.Z.; writing—review and editing, M.Z., A.A., A.O., and M.M; visualization, Z.H., M.Z., M.M., A.O., and A.A; supervision, M.Z. and A.A; project administration, M.Z.; funding acquisition, M.Z. and A.A. All authors have read and agreed to the published version of the manuscript.

Acknowledgments: The authors thank the expert technical assistance of SabzBava-ran-e-NouAndish Co. for providing laboratory assistance and equipment for part of the study.

Conflicts of Interest: The authors declare no conflict of interest.

Data Availability Statement: The data presented in this study are available on request from the corresponding author.

Bartelds, B., Takens, J., Smid, G.B., Zammit, V.A., Prip-Buus, C., Kuipers, J.R., and van der Leij, F.R., 2004. Myocardial carnitine palmitoyltransferase I expression and long-chain fatty acid oxidation in fetal and newborn lambs. American Journal of Physiology-Heart and Circulatory Physiology, 286(6), H2243-H2248. doi:10.1152/ajpheart.00864.2003
Bauchart, D., Legay-Carmier, F., Doreau, M., and Gaillard, B., 1990. Lipid metabolism of liquid-associated and solid-adherent bacteria gin rumen contents of dairy cows offered lipid-supplemented diets. British Journal of Nutrition, 63(3), 563–578. doi:10.1079/BJN19900143
Dervishi, E., Serrano, C., Joy, M., Serrano, M., Rodellar, C., and Calvo, J.H., 2011. The effect of feeding system in the expression of genes related with fat metabolism in semitendinous muscle in sheep. Meat Science, 89(1), 91–97. doi: 10.1016/j.meatsci.2011.04.003
Doepel, L., Lapierre, H., and Kennelly, J.J., 2002. Peripartum performance and metabolism of dairy cows in response to prepartum energy and protein intake. Journal of Dairy Science, 85, 2315–2334. doi: 10.3168/jds.S0022-0302(02)74312-9
Drackley, J.K., 1999. Biology of dairy cows during the transition period: The final frontier? Journal of Dairy Science, 82(11), 2259–2273. doi: 10.3168/jds.S0022-0302(99)75474-3
Drackley, J.K., Overton, T.R., and Douglas, G.N., 2001. Adaptations of glucose and long-chain fatty acid metabolism in liver of dairy cows during the periparturient period. Journal of Dairy Science, 84, E100-E112. doi: 10.3168/jds.S0022-0302(01)70204-4
Hernández-Castellano, L.E., Hernandez, L.L., and Bruckmaier, R.M., 2020. Endocrine pathways to regulate calcium homeostasis around parturition and the prevention of hypocalcemia in periparturient dairy cows. Animal, 14(2), 330–338. doi:10.1017/S1751731119001605
Lacetera, N., Bernabucci, U., Ronchi, B., and Nardone, A., 2001. Effects of subclinical pregnancy toxemia on immune responses in sheep. American Journal of Veterinary Research, 62(7), 1020–1024. doi: 10.2460/ajvr.2001.62.1020
Leonard, A.E., Pereira, S.L., Sprecher, H., and Huang, Y.S., 2004. Elongation of long-chain fatty acids. Progress in Lipid Research, 43(1), 36–54. doi: 10.1016/s0163-7827(03)00040-7
Loor, J.J., Dann, H.M., Everts, R.E., Oliveira, R., Green, C.A., Guretzky, N.A.J., Rodriguez-Zas, S.L., Lewin, H.A., and Drackley, J.K., 2005. Temporal gene exression profiling of liver from periparturient dairy cows reveals complex adaptive mechanisms in hepatic function. Physiological Genomics, 23(2), 217–226. doi: 10.1152/physiolgenomics.00132.2005
McGarry, J.D., Woeltje, K.F., Kuwajima, M., and Foster, D.W., 1989. Regulation of ketogenesis and the renaissance of carnitine palmitoyltransferase. Diabetes Metabolism Reviews, 5(3), 271–284. doi: 10.1002/dmr.5610050305
Reynolds, C.K., Aikman, P.C., Lupoli, B., Humphries, D.J., and Beever, D. E., 2003. Splanchnic metabolism of dairy cows during the transition from late gestation through early lactation. Journal of Dairy Science, 86:1201–1217.
Sadri, H., Mielenz, M., Morel, I., Bruckmaier, R.M., and van Dorland, H.A., 2011. Plasma leptin and mRNA expression of lipogenesis and lipolysis-related factors in bovine adipose tissue around parturition. Journal of Animal Physiology and Animal Nutrition, 95(6), 790–797. doi: 10.1111/j.1439-0396.2010.01111.x
Smit, E.F., Van Meerbeeck, J., Lianes, P., Debruyne, C., Legrand, C., Schramel, F., Smit, H., Gaafar, R., Biesma, B., Manegold, C., and Neymark, N., 2003. Three-arm randomized study of two cisplatin-based regimens and paclitaxel plus gemcitabine in advanced non-small-cell lung cancer: a phase III trial of the European Organization for Research and Treatment of Cancer Lung Cancer Group-EORTC 08975. Journal of Clinical Oncology, 21(21), 3909–3917.
van Dorland, H.A., Richter, S., Morel, I., Doherr, M.G., Castro, N., and Bruckmaier, R.M., 2009. Variation in hepatic regulation of metabolism during the dry period and in early lactation in dairy cows. Journal of Dairy Science, 92(5), 1924–1940. doi: 10.3168/jds.2008-1454
Voet, D., and Voet, J. G., 2004. Fundamentals of Biochemistry. 3rd ed. John Wiley and Sons, New York, NY.
Van Saun, R.J., 2000. Pregnancy toxemia in a flock of sheep. Journal of the American Veterinary Medical Association, 217, 1536–1539. doi: 10.2460/javma.2000.217.1536
Zakariapourbahnamiri, H., Ganjkhanlou, M., Zali, A., Sadeghi, M., and Moradi Shahrbabak, H., 2018a. Association between plasma metabolites and insulin sensitivity indexes in fat-tailed and thin-tailed lambs during negative and positive energy balances. Iranian Journal of Veterinary Medicine, 12, 259–271. doi: 10.22059/ijvm.2017.235952.1004818
Zakariapourbahnamiri, H., Ganjkhanlou, M., Zali, A., Sadeghi, M., Moradi, H., and Nehzati, G., 2018b. Expression of genes related to liver fatty acid metabolism in fat-tailed and thin-tailed lambs during negative and positive energy balances. Journal of Animal Physiology and Animal Nutrition, 130, 427–435. doi: 10.1111/jpn.13036
Zarrin, M., Sanginabadi, M., Nouri, M., Ahmadpour, A., and Hernández-Castellano, L., 2021. Prepartum and postpartum feed restrictions affect blood metabolites and hormones reducing colostrum and milk yields in fat-tailed dairy sheep. The Journal of Animals. 11, 1258. doi: 10.3390/ani11051258
Zarrin, M., Grossen-Rösti, L., Bruckmaier, R.M., and Gross, J.J., 2017. Elevation of blood β-hydroxybutyrate concentration affects glucose metabolism in dairy cows before and after parturition. Journal of Dairy Science, 100(3), 2323–2333. doi: 10.3168/jds.2016-11714
Zhong, J., Wan, W.X., Wei, Y., Slavin, J.A., Raines, J.M., Rong, Z.J., Chai, L.H., and Han, X.H., 2015. Compressibility of Mercury's dayside magnetosphere. Geophysical Research Letters, 42(23), 10–135. doi: 10.1002/2015GL067063

Effects of Isochronal Induced Feed Restriction With Transition Period On mRNA Abundance of The Hepatic Genes Related to Lipid Metabolism in Fat-Tailed Ewes

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Status:

Version 1