Mice
C57BL/6 mice maintained under SPF or GF conditions were purchased from Sankyo Laboratories Japan, SLC Japan, Charles River Japan or CLEA Japan. GF and gnotobiotic mice were bred and maintained within the gnotobiotic facility of RIKEN IMS. All animal experiments were approved by the Animal Care and Use Committee of RIKEN Yokohama Institute.
Collection of human faecal samples for trypsin activity assay and for colonization of GF mice with human microbiota
Human faecal samples were collected at RIKEN Institute (code H30-4, for patients with IBD) and Keio University (code 20150075, for healthy donors) according to the study protocols approved by the institutional review boards. Informed consent was obtained from each subject.
Bacterial strains
P. clara JCM14859, P. xylaniphila JCM14860, P. copri JCM13464, P. denticola JCM13449, P. stercorea JCM13469 and P. oulorum JCM14966 were acquired from the Japan Collection of Microorganisms (JCM). P. clara P237E3b and P322B5 strains were kindly provided by Vedanta Biosciences. P. xylaniphila 82A6 was a strain isolated in our laboratory47. P. rara (DSM 105141), P. rodentium (DSM 105243) and P. muris (DSM 103722) were obtained from DSMZ-German collection of Microorganisms and Cell Cultures GmbH. Bacterial strains are available under a contract with material transfer agreement with RIKEN.
Proteome analysis of caecal contents
Proteins in caecal contents were extracted by pipetting and inverting in TBST with protease inhibitors. After centrifugation at 15,000 × g for 20 min at 4°C to remove insoluble matter, supernatant was transferred to a new tube, 25% trichloroacetic acid was added (final concentration 12.5% v/v) and incubated for 1 h at 4°C. After removing the supernatant by centrifugation at 15,000 × g for 15 min at 4°C, the precipitate was washed twice with acetone and dried with the lid open. The dried sample was re-dissolved in 0.5% sodium dodecanoate and 100 mM Tris-HCl, pH 8.5 by using a water bath-type sonicator (Bioruptor UCD-200, SonicBio Corp., Kanagawa, Japan). The re-dissolved sample was assayed for protein concentration by the BCA assay and the protein concentration was adjusted to 1 μg/μl. The pretreatment of shotgun proteome analysis was performed as previously reported15.
Peptides were directly injected onto a 75 μm × 15 cm, PicoFrit emitter (New Objective, Woburn, MA, USA) packed in house with 2.7 μm core shell C18 particles (CAPCELL CORE MP 2.7 μm, 160 Å material; Osaka Soda Co., Ltd., Osaka, Japan) and then separated with a 180-min gradient at a flow rate of 300 nl/min using an Eksigent Ekspert NanoLC 400 HPLC system (Sciex, Framingham, MA, USA). Peptides eluting from the column were analysed on a TripleTOF 5600+ mass spectrometer (Sciex) for both shotgun-MS and sequential window acquisition of all theoretical mass spectra (SWATH)-MS analyses. For shotgun-MS based experiments, MS1 spectra were collected in the range of 400-1000 m/z for 250 ms. The top 25 precursor ions with charge states of 2+ to 5+ that exceeded 150 counts/s were selected for fragmentation with a rolling collision energy, and MS2 spectra were collected in the range of 100-1500 m/z for 100 ms. Dynamic exclusion time was set to 24 s. For SWATH-MS based experiments, the mass spectrometer was operated in a consecutive data-independent acquisition mode with 12 m/z increments in precursor isolation window. Using an isolation width of 13 m/z (1 m/z for the window overlap), a set of 50 windows was constructed covering the precursor mass range of 400–1000 m/z. SWATH MS2 spectra were in the range of 100–1500 m/z for 60 ms per MS2 experiment. Precursor ions were fragmented for each MS2 experiment using rolling collision energy.
All shotgun-MS files were searched against the mouse UniProt reference proteome (Uniprot id UP000000589, reviewed, canonical) using ProteinPilot software v. 4.5 with the Paragon algorithm (Sciex) for protein identification. The protein confidence threshold was a ProteinPilot unused score of 1.3 with at least one peptide with 95% confidence. Global false discovery rate for both peptides and proteins was lower than 1% in this study. The identified proteins were quantified from SWATH-MS data using PeakView v.2.2 (Sciex).
Proteome analysis of P. clara culture supernatant
25% trichloroacetic acid (final concentration 12.5% v/v) was added to the P. clara culture supernatant and incubated for 1 h at 4°C. After removing the supernatant by centrifugation at 15,000 × g for 15 min at 4°C, the precipitate was washed twice with acetone and dried with the lid open. The dried sample was re-dissolved in 0.5% sodium dodecanoate and 100 mM Tris-HCl, pH 8.5 by using a water bath-type sonicator (Bioruptor UCD-200). The re-dissolved sample was assayed for protein concentration by the BCA assay, and the protein concentration was adjusted to 1 μg/μl. The pretreatment of shotgun proteome analysis was performed as previously reported15. Peptides were directly injected onto a 75 μm × 20 cm, PicoFrit emitter packed in house with 2.7 μm core shell C18 particles at 50°C and then separated with an 80 min gradient at a flow rate of 100 nl/min using an UltiMate 3000 RSLCnano LC system (Thermo Fisher Scientific, Waltham, MA, USA). Peptides eluting from the column were analysed on a Q Exactive HF-X (Thermo Fisher Scientific) for overlapping window DIA-MS15,48. MS1 spectra were collected in the range of 495-785 m/z at 30,000 resolution to set an automatic gain control target of 3 × 106 and maximum injection time of 55. MS2 spectra were collected in the range of more than 200 m/z at 30,000 resolution to set an automatic gain control target of 3 × 106, maximum injection time of “auto”, and stepped normalized collision energy of 22, 26, and 30 %. An isolation width for MS2 was set to 4 m/z and overlapping window patterns in 500-780 m/z were used window placements optimized by Skyline49.
MS files were searched against a P. clara spectral library using Scaffold DIA (Proteome Software, Inc., Portland, OR). The spectral library was generated from P. clara (UniProt id UP000000589, reviewed, canonical) protein sequence databases by Prosit50, 51. P. clara protein sequence database was independently created by metagenomic analysis. The Scaffold DIA search parameters were as follows: experimental data search enzyme, trypsin; maximum missed cleavage sites, 1; precursor mass tolerance, 8 ppm; fragment mass tolerance, 8 ppm; static modification, cysteine carbamidomethylation. The protein identification threshold was set both peptide and protein false discovery rates of less than 1%. Peptide quantification was calculated by EncyclopeDIA algorithm52 in Scaffold DIA. For each peptide, the four highest quality fragment ions were selected for quantitation. Protein quantification was estimated from the summed peptide quantification.
Peptidome analysis
To the caecal contents, ACN containing 0.1% TFA was added and dried in a centrifugal evaporator. Acetone was added to the dried sample and lipid-soluble small molecules were extracted with a water bath-type sonicator, followed by centrifugation at 15,000 × g for 15 min at 4°C. After the supernatant was removed, 70% ACN-HCl53 was added to the precipitate and the peptide was redissolved by a water bath-type sonicator, followed by centrifugation at 15,000 × g for 15 min at 4°C. The supernatant was transferred to a new tube and dried in a centrifugal evaporator. The dried sample was redissolved in 100 mM Tris-HCl and protease inhibitors, and treated with 10 mM dithiothreitol at 50°C for 30 min. Subsequently, the sample was alkylated with 30 mM iodoacetamide in the dark at room temperature for 30 min and were acidified with 0.5% trifluoroacetic acid (final concentration). The acidified sample was desalted by Monospin C18 (GL Sciences, Tokyo, Japan).
Peptides were directly injected onto a 75 μm × 25 cm PicoFrit emitter (New Objective) packed in-house with C18 core-shell particles (CAPCELL CORE MP 2.7 μm, 160 Å material; Osaka Soda Co., Ltd.) at 50°C and then separated with a 90 min gradient at a flow rate of 100 nl/min using an UltiMate 3000 RSLCnano LC system (Thermo Fisher Scientific, Waltham, MA, USA). Peptides eluting from the column were analysed on a Q Exactive HF-X (Thermo Fisher Scientific) for DDA-MS. MS1 spectra were collected in the range of 350 to 1,500 m/z with 120,000 resolution to hit an automatic gain control (AGC) target of 3 × 106. The 30 most intense ions with charge states of 2+ to 5+ that exceeded 4.4 × 103 were fragmented in a data-dependent mode by collision induced dissociation with a normalized collision energy of 26%, and tandem mass spectra were acquired on the Orbitrap mass analyser with a mass resolution of 30,000 at 200 m/z to set an AGC target of 1 × 105.
MS files were searched against the mouse UniProt reference proteome (Uniprot id UP000000589, reviewed, canonical) by PEAKS Studio. The search parameters were as follows: precursor mass tolerance, 8 ppm; fragment ion mass tolerance, 0.01 Da; enzyme, no enzyme; fixed modifications, carbamidomethylation; variable modifications, oxidation (M). The peptide identification was filtered to a peptide false discovery rate of less than 1%.
In-gel digestion and LC-MS/MS analysis
The protein bands were excised, and in-gel digestion was performed as described54. The digested peptides were directly injected onto a 75 μm × 12 cm PicoFrit emitter (New Objective) at 40°C and then separated with a 30 min gradient at a flow rate of 200 nl/min using an UltiMate 3000 RSLCnano LC system (Thermo Fisher Scientific, Waltham, MA, USA). Peptides eluted from the column were analyzed on a Q Exactive HF-X (Thermo Fisher Scientific) for DDA-MS. MS1 spectra were collected in the range of 380 to 1240 m/z with 120,000 resolution to hit an automatic gain control (AGC) target of 3 × 106. The 20 most intense ions with charge states 2+ to 5+ were data-dependently dissociated by collision-induced dissociation with step-normalized collision energies of 22, 26, and 30, and tandem mass spectra were acquired on the Orbitrap mass analyzer with 30,000 resolution to set an AGC target of 1 × 105.
MS files were searched against the P. clara protein sequence database with human PRSS2 sequence using PEAKS Studio. The search parameters were as follows: precursor mass tolerance, 8 ppm; fragment ion mass tolerance, 0.01 Da; enzyme, Trypsin; variable modifications, oxidation (M). Peptide and protein identifications were filtered so that both peptide and protein false discovery rates were less than 1%.
Western Blot
Mouse caecal and faecal samples were suspended and diluted 50-fold in PBS supplemented with a protease inhibitor cocktail (Roche cOmplete™, Mini, EDTA-free). Resuspended samples were centrifuged at 4°C, 15,000 × g for 10 min, and the supernatant was collected for Western Blot. Mouse pancreatic tissues were snap-frozen by liquid nitrogen and proteins were extracted by TRIzol Reagent (Thermo Fisher Scientific), and the final protein concentration was adjusted to 4 μg/μl. For SDS-PAGE and blotting, Novex® NuPAGE® SDS-PAGE Gel system (Thermo Fisher Scientific) and iBlot™ 2 Dry Blotting System (Thermo Fisher Scientific) were used according to the manufacturer’s instructions. In some earlier experiments SDS-PAGE and PVDF membrane (0.2μm Transfer Membranes Immobilon-PSQ Merck Millipore Ltd.) transfer were performed according to the manufacturer’s [XV PANTERA SYSTEM(DRC)] instructions. iBindTM Western Systems (Thermo Fisher Scientific) were used for staining throughout the study. Antibodies used in this study are as follows: Rabbit anti-mouse PRSS2 (Cosmo Bio Co., Ltd., CPA, Japan, custom-made), Rabbit anti-mouse HSP90 antibody (#4877, Cell Signaling TECHNOLOGY), Rabbit anti-human PRSS2 (LS-B15726, LSBio), Rabbit anti-human PRSS1 (LS-331381, LSBio), Rabbit anti-mouse TMPRSS2 (LS-C373022, LSBio, raised against a sequence at the protease domain), Rabbit anti-6-His Antibody(A190-214A, Bethyl laboratories), Goat anti-mouse IgA alpha-chain (HRP) (ab97235, Abcam), Rat anti-mouse kappa-chain (HRP) (ab99632, Abcam), Rabbit anti-mouse CELA3b (OACD03205, Avivasysbio), Anti-rabbit IgG (HRP-linked Antibody) (#7074, Cell Signaling TECHNOLOGY), Rabbit anti-mouse Reg3b (51153-R005, Sino Biological). Chemi-Lumi One (nacalai tesque) was used for chemiluminescence assay and Molecular imager®︎ ChemiDocTM XRS+ system (BIO-RAD) or iBrightTM FL1500 were used for imaging.
RT-qPCR
RNA from mouse pancreas, small intestine and colon organoids were extracted by TRIzol Reagent (Thermo Fisher Scientific). Extracted RNA was converted to cDNA using ReverTra Ace®️ qPCR RT Master Mix with gDNA Remover (TOYOBO). RT-qPCR analysis was conducted with Thunderbird SYBR qPCR Mix (TOYOBO) and Lightcycler480 (Roche) and analysed with the ΔΔCt method or using a standard curve generated from serial dilutions of pooled cDNA (for Tmprss2, Ceacam1 and Actb). Gapdh and Actb were used as the endogenous control. Primer sequences are as follows:
Gapdh Forward primer: 5’-GTCGTGGAGTCTACTGGTGTCTTC-3’
Gapdh Reverse primer: 5’-GTCATATTTCTCGTGGTTCACACC-3’
Prss2 Forward primer: 5’-TGTGACCCTCAATGCCAGAG-3’
Prss2 Reverse primer: 5’-AGCACTGGGGCATCAACAC-3’
Tmprss2 Forward primer: 5’-AACGCAAGCCTCAACATCTG-3’
Tmprss2 Reverse primer: 5’-AACCTCCAAAGCAAGACAGC-3’
Ceacam1 Forward primer: 5’-GCCTGGCTTAGCAGTAGTGT-3’
Ceacam1 Reverse primer: 5’-CCAGGAGGCTAAAAGTGAGG-3’
Actb Forward primer: 5’-TTGCTGACAGGATGCAGAAG-3’
Actb Reverse primer: 5’-ATCCACATCTGCTGGAAGGTG-3’
Immunofluorescence
Mouse colon tissues (faecal pellet-containing) were sampled and fixed with Cornoy solution (60% methanol, 30% chloroform, 10% glacial acetic acid) at 4°C overnight. Tissue Processor (Leica MICROSYSTEMS) was used for paraffin embedding. Paraffin blocks were processed into thin-sections (5.0μm) by a microtome, followed by paraffin removal and immunostaining. Antibodies used for immunofluorescence are as follows: Rabbit anti-PRSS2 antibody (LSBio), Alexa 488-labelled goat anti-rabbit IgG (Life Technologies), DAPI (4’-6-diamidino-2-phenylindole, DOJINDO), Rhodamine-labelled UEA1 (Ulex Europaeus Agglutinin 1, Vector Laboratories). Leica AF600 and confocal Leica TCS SP5 were used for immunofluorescence imaging.
Trypsin Activity assay of mouse and human faecal samples
Mouse intestinal luminal contents or faecal samples were diluted by 500-fold (w/v) in 0.9% NaCl solution. Human faecal samples were diluted by 200-fold (w/v) in 0.9% NaCl solution. Diluted solutions were vortexed with a mini-shaker for 20 min at 2,000 rpm, homogenized by pipetting and centrifuged at 4°C, 10,000×g for 15 min. Supernatant was collected for trypsin activity assay by Trypsin Activity Assay Kit (Colorimetric) (ab102531) according to the manufacturer’s protocol. Absorbance at 405 nm was measured by PerkinElmer 2030 Multilabel Reader in kinetic mode.
Colonization of GF mice with human microbiota
Human faecal samples [preserved in 20%(v/v) glycerol] were transferred to an anaerobic chamber, thawed and sieved through 100 μm meshes, transferred into a GF isolator and introduced into GF mice by oral gavage (200 μl/mouse). For antibiotics treatment, 0.5 g/L ampicillin (nacalai tesque), 0.5 g/L metronidazole (nacalai tesque) and 1.0 g/L tylosin (sigma) solutions were made with autoclaved tap water. Mice receiving oral gavage of caecal contents from donor C microbiota-colonized mouse were fed with antibiotic solutions for 12 days. Antibiotic solutions were replaced once per week.
Isolation and identification of colonized species from mouse caecal contents
Mouse caecal contents were mixed with glycerol-containing (20%) PBS in an anaerobic chamber and stocked at -80°C. An aliquot was diluted with TS broth (BD) in an anaerobic chamber and plated onto different agar plates: EG, ES, M10, NBGT, VS, TS (BD), BL (Eiken Chemical), BBE (KYOKUTO SEIYAKU), Oxoid CM0619 (Thermo Fisher Scientific), CM0619-supplemented SR0107 (Thermo Fisher Scientific), CM0619-supplemented SR0108 (Thermo Fisher Scientific), mGAM (NISSUI-Pharm) and Schaedler (BD). After 2 days incubation, colonies with different appearances were transferred to new EG plates. Colonies were then incubated in EGEF liquid medium overnight, mixed with glycerol [final concentration 20% (v/v)] and stocked at -80°C.
Formula of EG (Eggerth Gagnon) agar plates is as follows: Protease peptone No. 3 (10.0 g), Yeast Extract (5.0 g), Na2HPO4 (4.0 g), Glucose (1.5 g), Soluble starch (0.5 g), L-cysteine HCl (0.5 g), L-cystine (0.2 g), Tween 80 (0.5 g), Agar (4.8 g), horse meat extract (500 ml), water up to 1000 ml + defibrinated Horse blood (50 ml). For EGEF medium, exclude agar and replace defibrinated horse blood (50 ml) with Fildes solution (40 ml).
Bacterial DNA genome was extracted from the isolated strains using the same protocol as DNA isolation from faecal samples (below). 16S rRNA was amplified by PCR using KOD plus Neo (TOYOBO) kit according to the manufacturer’s protocol. Sanger sequencing was entrusted to Eurofins. Sequences were blasted against NCBI database. Primers for Sanger sequencing are as follows: F27 primer: 5’-AGRGTTTGATYMTGGCTCAG-3’; R1492 primer: 5’-TACGGYTACCTTGTTACGACTT-3’.
16S rRNA sequencing
Frozen mouse faecal samples were thawed and 100 µL of suspensions were mixed with 900 µL TE10 (10 mM Tris-HCl, 10 mM EDTA) buffer containing RNase A (final concentration 100 µg/mL, Invitrogen) and lysozyme (final concentration 3.0 mg/mL, Sigma). The suspension was incubated for 1 h at 37°C with gentle mixing. Purified achromopeptidase (Wako) was added to a final concentration of 2,000 unit/mL and the sample was further incubated for 30 min at 37°C. Then, sodium dodecyl sulfate (final concentration 1%) and proteinase K (final concentration 1 mg/mL, Nacalai) were added to the suspension and the mixture was incubated for 1 h at 55°C. High molecular mass DNA was extracted by phenol:chloroform:isoamyl alcohol (25:24:1), precipitated by isopropanol, washed with 70% ethanol, and resuspended in 100 µL of TE. PCR was performed using Ex Taq (Takara) and the 27Fmod primer [5ʹ-AATGATACGGCGACCACCGAGATCTACACxxxxxxxxACACTCTTTCCCTACACGACGCTCTTCCGATCTAGRGTTTGATYMTGGCTCAG -3ʹ] and the 338R primer [5ʹ-CAAGCAGAAGACGGCATACGAGATxxxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGCTGCCTCCCGTAGGAGT -3ʹ] to the V1–V2 region of the 16S rRNA gene [xxxxxxxx represents Miseq (Illumina) Index sequence]. PCR product was purified with Agencourt AMPure XP (Beckman Coulter) according to the manufacturer’s protocol. 16S rRNA library was created using Kapa library quantification Kit (Kapa Biosystems) according to the manufacturer’s protocol. 16S rRNA sequencing was conducted using the standard protocol of MiSeq Reagent kit ver3. The obtained 16S rRNA sequencing data was analysed as previously described55. UCLUST (https://www.drive5.com/) was used to construct OTUs. Taxonomy was assigned to each OTUs by search against the National Center for Biotechnology Information (NCBI) using the GLSEARCH program.
Gnotobiotic studies and quantification of faecal bacterial DNA.
With the exception of Phasolactobacterium faecium (3G4), isolated bacterial strains were incubated in an anaerobic chamber at 37°C for 1-2 days. Phasolactobacterium faecium was incubated on Oxoid CM0619 agar plates supplemented with 80 mM succinic sodium for 2-3 days and colonies were collected and resuspended in EGEF. Bacterial density was adjusted based on OD600 values and mixtures of the cultured strains were administered into GF mice (150 µL/mouse, approx. 1-2 × 108 CFU of total bacteria) by oral gavage. For quantification of faecal DNA of P. clara, P. merdae, B. uniformis, P. rodentium and P. muris, mouse faecal DNA was purified and quantitative real-time PCR was carried out to amplify a sequence specific to respective bacterial 16s rRNA gene using the THUNDERBIRD SYBR qPCR Mix (TOYOBO) on a LightCycler 480 System (Roche). For quantification of faecal DNA of the WT or D00502 P. clara, quantitative real-time PCR was carried out to amplify a sequence specific to the 00502 gene (for WT) or a sequence spanning the upstream and downstream fragment of the 00502 gene (for D00502). Standard curves were generated from serial dilutions of bacterial genomic DNA purified from in vitro bacterial cultures of the respective strains. For analyses of the total faecal bacterial DNA, a universal bacterial 16S rRNA gene primer pair was used56. All primers used for faecal bacterial DNA quantification are listed in Supplementary Table 5.
Bacterial whole-genome sequencing
Genomic DNA was extracted from the isolated bacteria including P. clara (1C4) strain and sheared to yield DNA fragments. Bacterial genome sequencing was performed by the whole-genome shotgun strategy supported by PacBio Sequel and Illumina MiSeq sequencing platforms. TruSeq DNA PCR-Free kit was used to prepare the library of the Illumina Miseq 2 x 300bp paired-end sequencing with target length = 550bp, and FASTX-toolkit (hannonlab.cshl.edu/fastx_toolkit) was used to trim and filter all the MiSeq reads with a >20 quality value (QV). SMRTbell template prep kit 2.0 was used to generate the library of the PacBio Sequel sequencing with target length = 10 - 15kbp without DNA shearing. Error correction of the trimmed reads was conducted by Canu (v1.8) with additional options (corOutCoverage = 10,000, corMinCoverage = 0, corMhapSensitivity = high) following internal control removal and adaptor trimming by Sequel. De novo hybrid assembly of the filter-passed MiSeq reads and the corrected Sequel reads was performed by Unicycler (v0.4.8), including a check of overlapping and circularization, and a circular contig was generated. Rapid Annotations based on Subsystem Technology (RAST) server and Prokka software tool were used for gene prediction and annotation of the generated contig. Default parameters were used for all software unless specified otherwise.
Citrobacter rodentium vaccination and infection
GF mice were pre-inoculated with 200 μL of 2-mix (B. uniformis and P. merdae) + WT or Δ00502 P. clara for 4 days. Mice were then orally administered peracetic acid-inactivated C. rodentium (1010 /mouse) once per week for three weeks. After three weeks of immunization mice were infected with an overnight culture of C. rodentium (150 µL/mouse) by oral gavage and sacrificed on day 14 post infection. Peracetic acid-inactivated C. rodentium was generated as previously described35. Briefly, overnight cultures of C. rodentium were harvested by centrifugation (16,000×g, 10 min) and resuspended at a density of 1010 per ml in sterile PBS. Peracetic acid (240990, Sigma) was added to the bacterial suspension (final concentration 0.4%) and incubated for 1 h at RT. After washing with sterile PBS for three times the final pellet was resuspended at a final concentration of 1011 particles/mL in PBS and stored at 4°C. The vaccine was tested before use by inoculating 100 µL of the inactivated vaccine into 200 mL LB medium and incubating overnight at 37°C to ensure complete inactivation. For colony formation unit (CFU) assay, caecal patches or caecal luminal contents were collected and homogenized in PBS, and serially diluted homogenates were plated on LB agar plates. CFUs were counted after overnight incubation at 37°C under aerobic conditions. For ex vivo evaluation of C. rodentium-specific IgA, caecal contents were diluted 5-fold (w/v) in LB medium, centrifuged, and the supernatant was filtered with sterile filter units with 0.22 µm pore size PVDF membranes before mixed with equal volumes of an in vitro overnight C. rodentium culture. The mixture was incubated at room temperature with gentle shaking for 1 h, and the agglutination effect was examined by a confocal microscope (Leica TCS SP8). Alternatively, following incubation the mixture was centrifuged, washed once with PBS, and the bacterial pellets were lysed with 1% SDS solution (in 50 mM Tris-HCl buffer supplemented with 5 mM EDTA). Lysates were stained with goat anti-mouse IgA alpha-chain (HRP) antibody (ab97235) by Western Blot to evaluate the amount of C. rodentium-binding (C. rodentium-specific) IgA in the caecal contents.
Mouse hepatitis virus (MHV) infection in vivo
MHV-2 was propagated in DBT cells as previously reported5. 5 weeks old GF C57BL/6N male mice were obtained from CLEA Japan or Sankyo Labo Service and housed in separate stainless-steel isolators. GF mice were orally inoculated with either 200 μL of 2-mix (B. uniformis and P. merdae) +WT P. clara or 2-mix+D00502 P. clara, or 34-mix+ WT P. clara or 34-mix+D00502 P. clara. Two weeks after inoculation, the mice were infected with 4.5x106 PFU of MHV-2 via intragastric gavage using a long (4 cm) catheter, and survival was monitored daily for 10 days. To detect and quantify MHV-2, livers and brains were collected at day 4 or day 5 post-infection and homogenized in DNA/RNA shield (Zymo Research). Viral RNA was extracted using Quick-RNA Viral Kit (Zymo Research) following the manufacturer's instructions, and cDNA was synthesized using ReverTra Ace (TOYOBO) and random primer (TOYOBO). Quantitative real-time PCR was carried out to amplify a fragment in the 5’ region of viral ORF1a (5’-AAGAGTGATTGGCGTCCGTAC-3’ and 5’-ATGGACACGTCACTGGCAGAG-3’) using the THUNDERBIRD SYBR qPCR Mix (TOYOBO) on a LightCycler 480 System (Roche). The quantity of MHV-2 was calculated based on a standard curve generated using a copy number predetermined plasmid inserted with cDNA of a 5’ region (175 bp) of viral ORF1a. For histological examination, livers were collected at day 5 post-infection and fixed with 4% paraformaldehyde overnight at 4°C. Hematoxylin and eosin (H&E) staining was performed at Pathology Analysis Center, Central Institute for Experimental Animals (CIEA). Briefly, fixed tissue was embedded in paraffin, serially sectioned at 5 μm thickness, and stained with hematoxylin and eosin (H&E). The images were captured with the BX-X800 microscope (Keyence).
Organoid culture and MHV-2 infection
Mouse small intestine and colon organoids were established as previously described57,58. Briefly, intestine tissues were opened longitudinally, washed with ice-cold PBS, cut into small pieces, and subsequently treated with 5 mM EDTA on a rocking shaker for 30 min at 4°C. After the supernatant was carefully removed, the remaining tissue was washed with PBS by pipetting up and down, followed by passed through 70 μm cell strainers, and centrifuged at 300 × g for 3 min. Isolated crypts were embedded in Matrigel (Corning) and cultured with organoid growth medium, as follows: Advanced DMEM/F-12 (Gibco) supplemented with 10 mM HEPES, 2 mM GlutaMAX, 100 U/mL penicillin, 100 μg/mL streptomycin, 20% Afamin/Wnt3a CM (MBL), 50 ng/mL mouse recombinant EGF (Gibco), 100 ng/mL mouse recombinant Noggin (Peprotech), 1 μg/mL human recombinant R-Spondin 1 (R&D Systems), 500nM A 83-01 (Tocris), 1× N2 supplement (Gibco), 1× B-27 supplement (Gibco) and 1 mM N-acetyl-L-cysteine (Sigma-Aldrich). Organoids were passaged mechanically every 4–5 days.
Before MHV-2 infection, organoids and MDCK cells were dissociated into single cells using TrypLE express. 2×105 cells were infected at multiplicity of infection (MOI) of 1 for 2 hours at 37°C, 5% CO2 in the presence or absence of 1 μg/ml TPCK trypsin (Thermo Scientific). After infection, cells were washed twice with DMEM/F-12, embedded in Matrigel in 48-well tissue culture plate and cultured in organoid growth medium at 37°C with 5% CO2. Each well contained 2×104 cells. At 24 hours after plating, samples were collected and suspended in DNA/RNA shield. Viral RNA copy number was determined as above.
In vitro degradation of trypsin
Overnight bacterial cultures were incubated with recombinant mouse trypsin (final concentration 1 µg/mL) for 1h, or human trypsin (final concentration 20 µg/mL) for 4h. The recombinant trypsin isoforms used in this study are as follows: mouse recombinant PRSS2 (50383-M08H, Sino Biological), human recombinant PRSS1 (LS-G135640), human recombinant PRSS2 (LS-G20167) and human recombinant PRSS3 (His-tag) (NBP2-52220). In some experiments, recombinant mouse PRSS2 was first treated with one of the following trypsin inhibitors for 30 min prior to incubation with P. clara: AEBSF (Sigma, final concentration 2 mM), Leupeptin (Sigma, final concentration 100 µM) and TLCK (Abcam, final concentration 100 µM). In some experiments P. clara was grown overnight in the presence of tunicamycin (Sigma, final concentration 10 µg/mL), or 2-fluro-L-fucose (Cayman Chemical, final concentration 250 µM), or DMSO control prior to incubation with recombinant mouse PRSS2. For experiments assessing the effect of Ca2+ P. clara was grown in a low Ca2+ mGAM medium with or without supplementation with 1 mM Ca2+ prior to incubation with mouse recombinant PRSS2. For experiments using P. clara supernatant the P. clara overnight culture was filtered with a sterile filter unit with 0.22µm pore size PVDF membrane.
Confocal microscopy
Recombinant mouse PRSS2 was labelled with Alexa Fluor™ 488 using Alexa Fluor™ 488 Antibody Labeling Kit (A20181, Thermo Fisher Scientific) and pre-treated with AEBSF inhibitor (150 µg/mL rmPRSS2 with 20 mM AEBSF). Alexa Fluor™ 488 labelled mouse PRSS2 was incubated with overnight bacterial cultures at a final concentration of 5 µg/mL for 20 min in an anaerobic chamber. The mixture was centrifuged, washed with PBS once and resuspended in PBS. Leica TCS SP8 confocal microscopy was used for confocal imaging.
Disuccinimidyl sulfoxide (DSSO) crosslinking
DSSO (A33545) was purchased from Thermo Fisher Scientific. P. clara (1C4) was incubated with AEBSF-pretreated recombinant mouse recombinant PRSS2 (50383-M08H, Sino Biological) for 20 min, washed once with PBS, and resuspended in 10 mM DSSO. The reaction was incubated at room temperature for 10 min and quenched by adding concentrated Tris-HCl buffer (final concentration 20 mM). After washing with PBS, the pellet was lysed with 1% SDS solution (in 50 mM Tris-HCl buffer supplemented with 5 mM EDTA). P. clara (1C4) without incubation with PRSS2 was processed in the same manner to serve as the negative control. Lysates were stained with rabbit anti-6-His antibody (A190-214A, Bethyl laboratories) and anti-rabbit IgG (HRP-linked Antibody) (#7074, Cell Signaling TECHNOLOGY) and analysed by Western Blot.
Protein staining of whole cell lysate, supernatant and glycan-containing proteins.
P. clara (1C4) was cultured overnight in the presence of Tunicamycin (Sigma, final concentration 10 µg/mL), or 2-fluro-L-fucose (Cayman Chemical, final concentration 250 µM), or DMSO control. Cultured bacteria were then pelleted, washed once with PBS and lysed with 1% SDS solution (in 50mM Tris-HCl buffer supplemented with 5mM EDTA). SDS-PAGE was conducted using Novex® NuPAGE® SDS-PAGE Gel system (Thermo Fisher Scientific). Glycan-containing proteins were stained with Pro-Q™ Emerald 300 Glycoprotein Gel and Blot Stain Kit (Thermo Fisher Scientific) as per the manufacturer’s protocol. Protein contents of the whole cell lysates were stained with Colloidal Blue Staining kit (Thermo Fisher Scientific). Supernatant proteins were first condensed using Amicon Ultra Centrifugal Filters (10 kD NMWL) and then stained with Colloidal Blue Staining kit (Thermo Fisher Scientific).
Mutant generation
The deletion mutants (D03049-03053, D00502 and D00509) of P. clara (JCM14859) were generated as previously described30 with minor modifications. Briefly, approximately 1 kb sequences flanking the coding region were amplified by PCR and assembled into the suicide vector pLGB30 using HiFi DNA Assembly (NEB) as per the manufacturer’s protocol. 1 ml aliquots of each reaction were transformed into electro-competent E. coli S17-1 lpir. Transformants were conjugated with P. clara (JCM14859) as follows. The donor and recipient strains were cultured in LB and EGEF media respectively, to an OD600 of 0.5 and mixed at a ratio of 1:1. The mixture was dropped onto an EGEF agar plate and incubated aerobically at 37°C for 16 h. Transconjugants were selected on EGEF agar plates containing tetracycline (10 mg/ml). Transconjugants were partially sensitive to rhamnose-induced ss-bfe1 toxin expression and in the presence of 10 mM rhamnose their growth was inhibited (with an overnight OD600 of ~0.3). Subsequently, to select for loss of plasmid from the genome by a second crossover, transconjugants were cultured in EGEF broth supplemented with 10 mM rhamnose for at least 3 generations until the transconjugants were outcompeted by the revertants (overnight OD600 reached ~1.0). The bacterial culture was then plated, single colonies were picked and successful deletions were confirmed by PCR. For generation of insertional mutants, a similar protocol was used: approximately 0.5~1 kb homologous sequences of the coding regions were assembled into the suicide vector pLGB30 and transformed into electro-competent E. coli S17-1 lpir. Transformants were conjugated with P. clara (JCM14859) using the same protocol and transconjugants were selected on EGEF agar plates containing tetracycline (10 mg/ml), confirmed by PCR and maintained in EGEF broth supplemented with tetracycline (10 mg/ml). All primers used for mutagenesis are listed in Supplementary Table 5.
Transmission Electron Microscope (TEM)
Wild type (WT) or D00502 P. clara (JCM14589) strains were incubated with mouse recombinant PRSS2 (50383-M08H, Sino Biological, final concentration 5 µg/mL) for 20 min, washed with PBS, and fixed with 4% paraformaldehyde-1% glutaraldehyde solution at room temperature for 2 h. After washing with 0.05 M PBS, pellets were dehydrated in graded series of ethanol (50%, 70%, 80%, 90%, 95% and 100%). Dehydrated pellets were infiltrated with LRW resin (1:1 of 100% ethanol and LRW for 1 h, then 1:2 of 100% ethanol and LRW overnight, and then 100% LRW for 5 h). After infiltration samples were cured in gelatin capsules (53°C for 24 h). Polymerized LRW blocks were sectioned with a Leica Ultracut UCT and 80 nm sections were obtained. For immuno-gold staining sections were first blocked with 0.05 M PBS supplemented with 1% BSA, followed by staining with Rabbit anti-6-His antibody (A190-214A, Bethyl laboratories) for 60 min. After washing with 0.05 M PBS sections were stained with 12 nm Colloidal Gold Goat Anti-Rabbit IgG for 60 min. After washing again with 0.05 M PBS, sections were fixed with 1% Glutaraldehyde in 0.05 M PBS, washed with H2O and stained with uranyl acetate for 5 min. All images were taken by a JEOL JEM-1400 transmission electron microscope.
Recombinant protein expression, coupling to magnet microbeads and Blue Native (BN) gel electrophoresis
For generation of recombinant 00502 and 00509 the coding regions of both genes (excluding the N-terminal sequences coding the signal peptides) were cloned into the expression vector pET-28b (+) (Novagen, #69865) to introduce a C-terminal His-tag following the supplier’s protocol. Expression vectors were transformed into Rosetta-gami B(DE3) competent cells (Novagen, #71136). Transformants were grown to the exponential phase and protein expression was induced by supplementation with 0.4 mM IPTG (Sigma, I6758). Following overnight culture at 25°C, cells were lysed with B-PER™ Bacterial Protein Extraction Reagent (Thermo Fisher Scientific, #78243), and recombinant 00502 and 00509 were purified with PierceTM Ni-NTA Magnetic Agarose Beads (Thermo Fisher Scientific, #78605) and PierceTM Polyacrylamide Spin Desalting Columns (Thermo Fisher Scientific, #89849). Purified recombinant 00502 and 00509 or bovine serum albumin (Thermo Fisher Scientific, #23209) were coupled to the micromagnetic beads (DynabeadsTM) with DynabeadsTM Antibody Coupling kit (Thermo Fisher Scientific, 14311D) following the manufacturer’s protocol, with 15 mg protein input per mg beads. For downstream analyses, 1 mg protein-coupled DynabeadsTM were resuspended in 200 mL EGEF medium and mixed with recombinant mouse PRSS2 (final concentration 3 µg/mL), AEBSF-pre-treated Alexa Fluor™ 488 labelled recombinant mouse PRSS2 (final concentration 5 µg/mL) or 50 mL GF caecal contents (50-fold dilution in PBS). For BN gel electrophoresis, recombinant 00502 and 00509 were purified with anion-exchange and nickel-affinity chromatography from r00502- or r00509-expressing Rosetta-gami B(DE3) E. coli. Native PAGE Bis-Tris Gel System (Thermo Fisher Scientific, #BN1002BOX and #BN2007) was used following the manufacturer’s protocol. To detect the r00502-trypsin complex, 100 µg/mL or 400 µg/mL recombinant human PRSS2 was pre-treated with 20 mM AEBSF trypsin inhibitor for 30 min, incubated with r00502 (100 µg/mL) and then loaded to Native PAGE gels. SERVANativ Marker Liquid Mix (SERVA, #39219) was used as the protein standard. For Western blot analysis of BN gels proteins were blotted using iBlot™ 2 Dry Blotting System with PVDF membranes (Thermo Fisher Scientific). Primers used for generation of the recombinants are listed in Supplementary Table 5.
Protease activity assay
Pierce™ Fluorescent Protease Assay Kit (Thermo Fisher Scientific, #23266) was used to determine the protease activity of the P. clara culture, the P. clara culture supernatant, recombinant 00502 and 00509 following the manufacturer’s protocol. PerkinElmer 2030 Multilabel Reader with fluorescein excitation and emission filters (485/538nm) was used to detect increased total fluorescence as the FTC-Casein substrate was digested by proteases into smaller fluorescein-labelled fragments. Protease activity was expressed as change in relative fluorescence units (RFU).
Ex vivo degradation of IgA by faecal and recombinant trypsin
Faeces from the 2-mix+WT P. clara colonized mice and GF mice was filtered to remove the bacteria, diluted 50-fold in PBS, mixed at a ratio of 1:1 (in the presence or absence of 100 µM trypsin inhibitor TLCK) or mixed with an equal volume of PBS (final dilution 100-fold), followed by incubation at 37°C for 24 h. Alternatively, filtered and diluted (100-fold in PBS) faeces from the 2-mix+WT P. clara colonized mice was incubated at 37°C for 24 h with different concentrations of recombinant mouse PRSS2 (0-16 µg/mL). After incubation the trypsin activity and the protein contents of the samples were analysed by trypsin activity assay and Western Blot as aforementioned.
Metagenomic analysis of the human gut microbiome
Metagenomes from human faecal samples from PRISM59, HMP260, FHS42, 500FG61, CVON62 and Jie63 were de novo assembled into a non-redundant gene catalogue, compiled into metagenomic species using MSPminer64 and quantified in terms of relative abundance in a previous study42. To search in the gene catalogue for the homologues of P. clara and P. xylanphila genes from the trypsin associated locus containing genes 00502 and 00509, as well six other neighboring genes, we employed USEARCH65 ublast (at protein level) retaining hits with a minimum e-value of 0.1. We confirmed the presence of all 8 genes in both species in the gene catalogue. To identify additional plausible homologues and species encoding this locus, we first evaluated the similarity between the corresponding homologues in P. clara and P. xylanphila, and set the following thresholds of minimal identity (Id) and coverage (Cov) for ublast hits to each gene in the locus: 00502 Id=25%, Cov=90%, 00503 Id=70%, Cov=90%, 00504 Id=60%, Cov=90%, 00505 Id=60%, Cov=90%, 00506 Id=50%, Cov=90%, 00507 Id=25%, Cov=90%, 00508 Id=45%, Cov=80%, 00509 Id=20%, Cov=30%. We then evaluated which other metagenomic species (MPSs) encoded homologues to P. clara and P. xylanphila 00502-00509, identifying MSP 0355 and MSP 0303. While MSP 0355 and MSP 0303 were previously only annotated to phylum Bacteroidetes42, we used ublast to compare their proteomes to the unified human gastrointestinal genome (UHGG) collection66. In both cases, most of the genes (>90%) mapped with high confidence (median amino acid identity >99% and e-value <1e-184) to a single species representative in UHGG, annotating MSP 0355 and MSP 0303 as GUT_GENOME140082 and GUT_GENOME016875, respectively; in UHGG66 both were phylogenetically classified as Paraprevotella spp. Additionally, we identified five MSPs that encoded homologues to only 00502 and 00509: MSP 0081, MSP 0224, MSP 0288, MSP 0410 and MSP 0435. To evaluate which individuals in the COVID-19 cohort (described below) carried P. clara’s gene 00502 or its homologues, we quality controlled faecal metagenomic data using Trim_Galore! to detect and remove sequencing adapters (minimum overlap of 5 bp) and KneadData v.0.7.2 to remove human DNA contamination and trim low-quality sequences (HEADCROP:15, SLIDINGWINDOW:1:20), and retained reads that were at least 50 bp long. Paired-end quality filtered reads were mapped to the same gene catalogue from a previous study42 with BWA67, filtered to include strong mappings with at least 95% sequence identity over the length of the read, counted and normalized to transcript-per-million (TPM matrix). Detection (TMP>0) of any of the 00502 homologues classified the sample as containing a 00502 gene in their gut microbiome. All metagenomic samples in the COVID-19 cohort had at least 8 million reads after quality filtering.
COVID-19 cohort
The COVID-19 cohort was recruited as a part of the Japan COVID-19 Task Force (JCTF) study68. According to the study protocol approved by the institutional review board at Keio University (code 20190337), we recruited 146 patients who were diagnosed as COVID-19 by physicians using the clinical manifestation and PCR test results and hospitalized at Keio University Hospital from March 2020 to September 2021. Informed consent was obtained from each subject. Approximately two months after discharge from the hospital, faecal samples were collected and sent to the laboratory in DNA/RNA Shield (Zymo Research). Among the 146 subjects, information of oxygen inhalation was available for all participants, whereas that of diarrhoea incidence was available for 141 cases from the medical records during hospital care. Microbial DNA was extracted from 100 ml of faecal suspension as above. Extracted DNA was sheared using M220 Focused-ultrasonicater (Covaris) to obtain fragmented DNA around 500 bp size. Metagenomic sequencing libraries were prepared from 200 ng of fragmented DNA using TruSeq DNA Nano Library Preparation kit with IDT for Illumina-TruSeq DNA UD Indexes (Illumina) according to the manufacturer’s recommended protocol. Libraries were pooled by equal DNA amount, and library size and concentration were evaluated by 4200 TapeStation (Agilent Technologies) and Qubit 3 Fluorometer (Invitrogen) respectively. Sequencing was performed on an Illumina NovaSeq 6000 with 151 bp paired-end reads. The quality control for the metagenomic data was conducted using ParDRe v2.1.5 (ref. 69) to remove duplicated reads, and fastp v0.20.0 (ref. 70) to remove low-quality sequences (<Q20, 50% of bases), adapter sequences and polyG tails. Minimap2 v2.17 (ref. 71) was used to remove PhiX and human DNA contamination.
Statistics
All statistical analyses were performed using GraphPad Prism software (GraphPad Software, Inc.). One-way ANOVA with Tukey’s test was used for multiple comparisons. Mann-Whitney test with Welch’s correction (nonparametric) or unpaired t test (parametric) were used for comparison between two groups. Spearman rank correlation was used to investigate the correlation between two variables. Log-rank (Mantel-Cox) test was used for survival analysis. One-sided Fisher's test was used to determine whether the two groups differ in the proportion with which they fall into the two classifications.