High Level of Heterozygous Haplotype of Hemoglobin in Abidjan

doi:10.21203/rs.3.rs-776734/v1

Background.

Sickle cell disease (SCD) is an hemoglobin disorder that concerns 300,000 newborns each year around the world. Hemoglobin haplotypes can modulate SCD clinical expression. In Côte d’Ivoire, no study has yet investigated the distribution of hemoglobin haplotypes in the population. The goal of this study was to identify hemoglobin haplotypes for people attending dispensary with mild malaria in Abidjan (Ivory Coast) independently of their SCD status.

Methods

To determine haplotypes, specific restriction enzyme (RE) method is used after PCR amplification with different couples of primers. According to the digestion profile of PCR products, five hemoglobin haplotypes are found over the world.

Results

In Abidjan, four different “classical” haplotypes of hemoglobin were detected: Benin (56.5%), Bantou (28.5%), Senegal (4%), Cameroun (1%). In parallel 10% of atypical profiles were described. Heterozygous haplotype (69%) was more frequent than homozygous haplotype (31%).

Conclusions

Benin haplotype usually associated with more severe of SCD symptoms was predominant in the study population. However this preliminary study highlights also a high prevalence of atypical and heterozygous haplotypes in the population.

Epigenetics & Genomics

Sickle cell anemia

haplotype

Ivory coast

Malaria

Sickle cell disease (SCD) is a hemoglobin disorder that concerns 300,000 newborns yearly over the world (1). Sub-Saharan countries harbored the highest prevalence of SCD with S hemoglobin in Central Africa and C in Sahelian areas (2–4). However, haemoglobin haplotypes can modulate clinical expression of SCD. These haplotypes have different geographic origins (5, 6). The presence of some haplotypes can reduce the SCD symptoms, whereas other ones amplify clinical manifestations (7–14). To determine these haplotypes, specific restriction enzymes (RE) are used after PCR amplification. According to these digestion profiles five hemoglobin haplotypes can be described around the world: Bantou (CAR), Arabic, Senegal, Cameroun and Benin (15, 16). In Côte d’Ivoire, no study has yet investigated the distribution of haplotypes in population, and especially among people with SCD. This first study has been conducted retrospectively in Côte d’Ivoire to identify these haplotypes from peoples attending dispensaries with mild malaria independently to their SCD statute.

Sample collection

Abidjan is the economic capital of Côte d’Ivoire with five million inhabitants originating from a large number of neighboring countries. Participants were recruited at the CSUCOM Anonkoua-Kouté (Abidjan, Abobo) between 2013 and 2016 among patients attending the center with confirmed mild malaria (parasitemia more than 2000 parasites/µL blood).

The hemoglobin status of the patients was determined based on a standard acetate electrophoresis of hemoglobin using Sebia® Hemoglobin electrophoresis, following the protocol of the manufacturer. For molecular typing, 50 µL of total blood was dried on 5M Whatman® paper and stored in zip locked bag contained silicate gel until use in 2020.

Haplotype molecular typing

For molecular typing, DNA purification was performed on blood spots using the Qiagen®Blood Minikit as recommended by the manufacturer. For amplification, different programs were used according to the couple of primers used. Nine pairs of primers have been used following Sutton and al (15) and Doupa and al (17) (Table 1). After amplification, each type of PCR products was digested with a related restriction enzyme (RE). The haplotype profiles were identified according to Sutton and al (15) and Doupa and al (17). (Table 2)

Table 1

Primers used in this study
Primer name	Primer sequence	Source
5’ Gγ	AACTGTTGCTTTATAGGATTT T AGGAGCTTATTGATAACCTCAGAC	(17)
Gγ	TGCTGCTAATGCTTCATTACA A AAGTGTGGAGTGTGCACATGA
Aγ	TGCTGCTAATGCTTCATTACA A TAA ATGAGGAGCATGCACACA C
Ψβ	GAA CAG AAG TTG AGA TAG AGA ACT CAG TGG TCT TGT GGG CT
3’Ψβ	TCT GCA TTT GAC TCT GTT AGC GGA CCC TAA CTG ATA TAA CTA
3’ δ	TGG ATT CTG CCT AAT AAA A GGG CCT ATG ACA GGG TAA T
Β	GCT GAG GGT TTG AAG TCC AA CAC TGA TGC AAT CAT TCG TC
5' β	CTACGCTGACCTCATAAATG CTAATCTGCAAGAGTGTCT	(15)
3' β	TTCATACATAACAATACTCA GAGGAGAGCTTTACTTCCAA	(15)

Demographic results

Out of a total of 100 patients included in the study, 55% were women, with a mean age of 14.5 years.

Haplotype typing

Four different “classical” haplotypes of hemoglobin were detected, Benin (56.5%), Bantou (28.5%), Senegal (4%) and Cameroun (1%). The Arabic haplotype was not observed. In addition, 10% of atypical profiles were detected (i.e. 20 haplotypes). Atypic haplotypes were predominant in the of Benin (19/20) and Bantou (01/20) groups (Table 2, Fig. 1). Heterozygous (69%) were more frequent than homozygous (31%). For homozygote, women were more affected by SCD than men (40/69 and 29/69 respectively).

Table 2

Haemoglobin haplotype restriction profiles

(+ ) presence of restriction enzyme site, (-) absence of restriction enzyme site; CAR = Central African Republic; (nbr of allele) for 20 atypic alleles.

	Gene and restriction enzyme
	5gamma (XmnI)	Gamma (HindIII)	Alpha (HindIII)	phiBêta (HincII)	3phiBêta (HincII)	3Delta (HinfI)	Beta (AvaII)	5Beta (HinfI)	3Beta (HpaI)
Haplotype described (2,3)
Senegal	+	+	-	+	+	+	+	+	+
Benin	-	-	-	-	+	-	+	+	-
Bantu (CAR)	-	+	-	-	-	-	+	+	+
Cameroon	-	+	+	-	+	+	+	-	+
Arabic	+	+	-	+	+	-	+	-	+
Atypic in this study
With Bantu haplotype
Atypic 1(1) *	-	-	-	-	+	+	+	+	+
With Benin haplotype
Atypic 1(4) *	-	-	-	-	+	+	+	+	+
Atypic 2(10) *	-	+	-	-	+	+	+	+	+
Atypic 3(4) *	-	+	-	-	+	-	+	+	+
Atypic 4(1) *	-	-	-	-	+	-	+	+	+

Hemoglobin typing and malaria diagnostic

The AA genotype represented 87% of the samples. The other genotypes were AC, AS, SC and CC (8%, 2%, 2% and 1% respectively, Table 3).

Mean parasitemia was 46376 parasites/µL blood, without any significant difference between haplotypes (t-test, p = 0,95).

All participants with AC or CC genotypes were from the Benin group (homozygote Benin/Benin or Benin/Bantu) whereas AS was found in the Bantu group (Table 3). Atypic, Cameroun and Senegal haplotypes were observed only in normal hemoglobin group (Table 3).

Table 3

Distribution of haplotypes according to malaria and haemoglobin type
	Mean parasitaemia (tpz/µL blood)	Hemoglobin typing (N*)					Total (N*)
	Mean parasitaemia (tpz/µL blood)	AA	AC	AS	CC	SC	Total (N*)
With Benin haplotype
Benin/Atypic	44644	14	1				15
Benin/Benin	40342	20	1		1	1	23
Cameroon/Benin	43768	2					2
Senegal/Benin	31017	6	1				7
		42	3		1	1	47
With Bantu haplotype
Atypic/Bantu	84307	1					1
Bantu/Bantu	75460	5		1			6
Senegal/Bantu	21866	1					1
		7		1			8
With Bantu and Benin haplotypes
Bantou/Benin	48930	36	5	1		1	43
Another haplotype
Atypic/Atypic	36279	2					2
Total	46376	87	8	2	1	2	100
*nbr of patients

Several authors have highlighted the interest of studying hemoglobin haplotypes for individuals with hemoglobin disorders as a modulation of the clinical profile of the disease can occur (7–14). In Côte d'Ivoire, not data was available on these haplotypes. This study updates these data for people living in Abidjan and experimenting mild malaria. During this work, women represented the highest proportion of people attending dispensaries. This is frequently observed as men use to practice self-treatment so are rarely visiting dispensaries. A prevalence of 13% of sickle cell disease was found in this population, which is in line with a previous study conducted in the same area (18).

The Benin haplotype was the most prevalent followed by the Bantu one, which can be attributable respectively to ethnic origin of the population in Abidjan, and the high level of migration from central Africa to Ivory Coast. Arab-Indian haplotype was not observed despite migration of populations across the Sahel (Peul and Toucouleur ethnics). A small prevalence of Senegal and Cameroon haplotypes was observed. These different prevalence are in line with the geographical origin of the different populations living in Abidjan (5, 6).

Similar other studies reporting 5 to 10% of atypical haplotypes (9, 19–21), this study reports 10% of atypical haplotypes in the population of Abidjan, mostly associated with the Benin haplotype. This association is important to explore as Benin haplotype is associated with a more severe form of expression of SCD.

Overall a high proportion of heterozygous genotype (61%) was found in Abidjan. That differs from the studies conducted by Doupa et al (32%) (17). This difference could be due to the selection of patients harboring SCD and to the use of only one single restriction site, by these authors. The emergence of these atypics haplotypes and the high proportion of heterozygous haplotypes could support a high level of mixed populations in Abidjan. Indeed, Abidjan is one of the major cities in West Africa, with a cosmopolite population. In addition, this important mix of populations would support a higher frequency of recombination between haplotypes leading to atypic profiles. Indeed, in line with other studies (19, 22, 23), the atypical haplotypes observed show strong similarities with the Benin and Bantu haplotypes. The high proportion of atypical haplotype and its similarity with the Benin haplotype could be explained by a selection pressure. Indeed, the association of an atypical haplotypes with the more severe Benin haplotype may modulate as well the clinical pattern of the disease, leading to an attenuated clinical expression.

In this preliminary study, a high prevalence of atypical and heterozygous haplotype was highlighted. Benin haplotype usually associated with severity of SCD was the most prevalent. Further studies involving a large number of SCD participants could help to estimate an accurate prevalence of hemoglobin haplotypes in Côte d’Ivoire.

SCD: Sickle cell disease

RE: Restriction Enzyme

PCR : Polymerase Chain Reaction

√ Ethics approval and consent to participate

This study is a part of a protocol of survey of sickle cell anemia in Abidjan which received ethical clearance from the National Ethic Committee of Ivory Coast. All the participants gave their informed consent to participate

√ Consent for publication

All the authors read the manuscript and agreed with the publication

√ Availability of data and materials

The datasets used and/or analysed during the current study are available in the OneDrice repositoryhttps://1drv.ms/u/s!AnZdvsbBxlN05UlxWwj8x_1ldWKU?e=o1Aq7P

√ Competing interests

The authors declare that they have no competing interests.

√ Funding

This study and KOUI TOSSEA STEPHANE were supported by the Rotary International Foundation

√ Authors' contributions

KOUI TOSSEA STEPHANE conducted the laboratory study and wrote the manuscript; GNONDJUI A. ALBERT, AKO AKO ARISTIDE BERENGER and COULIBALY BABA participated in the collection of the blood sampling; ADJI A. ERIC participated to the PCR design; AKA A. DELPECHE realized the laboratory study ; GONEDELE BI S. E. and TOURE O. ANDRE participated to the study design and reviewed the manuscript ; RONAN JAMBOU supervised the study, obtained the ethic clearance and the founds, wrote the protocol and co-wrote the manuscript.

√ Acknowledgements

We would like to thank all the people and institutions that have enabled us to carry out this work. This work and KS were supported by the Rotary international Foundation and the District of Paris (France). .

√ Authors' information (optional)

KOUI TOSSEA STEPHANE: Genetic PhD student (Félix Houphouët-Boigny University)

GNONDJUI A. ALBERT: Biochemistry PhD student (Félix Houphouët-Boigny University)

AKO AKO ARISTIDE BERENGER: Research Scientist, Department of Parasitology-Mycology (Institut Pasteur Côte d’Ivoire)

COULIBALY BABA: Genetic PhD student (Félix Houphouët-Boigny University)

ADJI A. ERIC: Genetic PhD student (Félix Houphouët-Boigny University)

AKA A. DELPECHE: MSC Molecular Genetics and Species Improvement (Félix Houphouët-Boigny University)

GONEDELE BI S. E.: Lecturer, Biosciences department (Félix Houphouët-Boigny University)

TOURE O. ANDRE: Senior Scientist, Head of the Department of Parasitology-Mycology (Institut Pasteur Côte d’Ivoire)

RONAN JAMBOU: Research Director, Institut Pasteur Paris / CERMES Niger

WHO. Sickle Cell Disease | Regional Office for Africa [Internet]. [cited 2020 Nov 29]. Available from: https://www.afro.who.int/fr/node/596
Délicat-Loembet L, et al. Prevalence of the sickle cell trait in Gabon: A nationwide study. Infect Genet Evol. 2014;25:52–6.
SIHIO-TS. Société Ivoirienne d ’ Hématologie-Immunologie Oncologie-Transfusion sanguine. 2018.
Assemblée mondiale de la Santé 59. Drépanocytose: rapport du secrétariat [Internet]. 2006. Available from: http://www.who.int/iris/handle/10665/21941#sthash.Rea4mfwr.dpuf
Shriner D, Rotimi CN. Whole-Genome-Sequence-Based Haplotypes Reveal Single Origin of the Sickle Allele during the Holocene Wet Phase. Am J Hum Genet [Internet]. 2018;102(4):547–56. Available from: https://doi.org/10.1016/j.ajhg.2018.02.003
Pagnier J, J. Gregory M, DUNDA-BELKHODJA O, SCHAEFER-REGO KE, BELDJORD C, NAGEL RL, et al. Evidence for the multicentric origin of the sickle cell hemoglobin gene in Africa. Proc Natl Acad Sci USA [Internet]. 1984 [cited 2019 Aug 5];81:1771–3. Available from: https://www.pnas.org/content/81/6/1771.short
Abou-Elew HH, Youssry I, Hefny S, Hashem RH, Fouad N, Zayed RA. βS globin gene haplotype and the stroke risk among Egyptian children with sickle cell disease. Hematology. 2018 Jul 3;23(6):362–7.
Maria AL da S, R. Friedrisch J, M. Bittar C, Urnau M, Merzoni J, S. Valim V, et al. B-Globin Gene Cluster Haplotypes and Clinical Severity in Sickle Cell Anemia Patients in Southern Brazil. Open J Blood Dis. 2014;04(02):16–23.
Rolim A, Martins L, Siebra M. B-Globin Gene Cluster Haplotypes in a Cohort of 221 Children with Sickle Cell Anemia or SB0-Thalassemia and Their Association with Clinical and Hematological Features. Acta Haematol. 2010;124:162–70.
Steinberg MH. Predicting clinical severity in sickle cell anaemia. Br J Haematol. 2005;129(4):465–81.
Zago MA, Figueiredo MS, Ogo SH. Bantu βs cluster haplotype predominates among Brazilian Blacks. Am J Phys Anthropol [Internet]. 1992 Jul 1 [cited 2020 Nov 27];88(3):295–8. Available from: http://doi.wiley.com/10.1002/ajpa.1330880304
Labie D, Elion J. Modulation polygénique des maladies monogéniques: L’exemple de la drépanocytose. Medecine/Sciences. 1996;12(3):341–9.
Laurentino MR, Maia Filho PA, Barbosa MC, Bandeira ICJ, Rocha LB da S, Gonçalves RP. Influence of βS-globin haplotypes and hydroxyurea on tumor necrosis factor-alpha levels in sickle cell anemia. Rev Bras Hematol Hemoter. 2014;36(2):121–5.
Simonnet C, Elanga N, Joly P, Vaz T, Nacher M. Genetic modulators of sickle cell disease in French Guiana: Markers of the slave trade. Am J Hum Biol [Internet]. 2016 Nov 1 [cited 2020 Nov 11];28(6):811–6. Available from: http://doi.wiley.com/10.1002/ajhb.22871
Sutton M, Bouhassira EE, Nagel RL. Polymerase chain reaction amplification applied to the determination of β-like globin gene cluster haplotypes. Am J Hematol [Internet]. 1989 Sep [cited 2017 Aug 16];32(1):66–9. Available from: http://doi.wiley.com/10.1002/ajh.2830320113
Joly P, Lacan P, Garcia C, Delasaux A, Francina A. Clinica Chimica Acta Rapid and reliable β -globin gene cluster haplotyping of sickle cell disease patients by FRET Light Cycler and HRM assays. Clin Chim Acta [Internet]. 2011; Available from: http://dx.doi.org/10.1016/j.cca.2011.03.025
Doupa D, Djité M, Kandji PM, Makalou D, Thiam S, Boye O, et al. Polymorphism of the Beta Gene in Homozygous Sickle Cell Patients in Senegal and Its Influence on the Main Complications of the Disease. Adv Biochem 2018; 2018;6(3):19–25.
Tossea SK, Adji EG, Coulibaly B, Ako BA, Coulibaly DN, Joly P, et al. Cross sectional study on prevalence of sickle cell alleles S and C among patients with mild malaria in Ivory Coast. BMC Res Notes [Internet]. 2018;1–7. Available from: https://doi.org/10.1186/s13104-018-3296-7
Zago MA, Silva WA, Dalle B, Gualandro S, Hutz MH, Lapoumeroulie C, et al. Atypical β(S) haplotypes are generated by diverse genetic mechanisms. Am J Hematol. 2000;63(2):79–84.
Cabral CHK, Serafim ÉSSS, de Medeiros WRDB, Fernandes TAA de M, Kimura EM, Costa FF, et al. Determination of β s plotypes in patients with sickle-cell anemia in the state of Rio Grande do Norte, Brazil. Genet Mol Biol. 2011;34(3):421–4.
Silva W dos S, Klautau-Guimarães de MN, Grisolia CK. β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil. Genet Mol Biol. 2010;33(3):411–7.
Srinivas R, Dunda O, Krishnamoorthy R, Fabry ME, Georges A, Labie D, et al. Likely to Be the Product of Recombination. 1988;62(1 988):60–2.
Gonqalves I, Bruno G. A novel mosaic Bantu/Benin/Bantu haplotype found in several African populations. 1994;101–3.

No competing interests reported.

KTPCRhaplotypesrestrictionHindIIIGamma932.jpg

High Level of Heterozygous Haplotype of Hemoglobin in Abidjan

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Sample collection

Haplotype molecular typing

Results

Demographic results

Haplotype typing

Hemoglobin typing and malaria diagnostic

Discussion

Conclusion

Abbreviations

Declarations