Chemicals and reagents
The vector pPICZ-A and Top10F’ bacterial competent cells were from Invitrogen and specific antibodies were from Millipore and Cell Signaling. SF9 insect cells and ESF 921 media were from Expression systems. Strep-Trap, His- Trap and gel filtration columns (Superdex 16/600 200 pg) were from GE. All other chemicals unless otherwise stated were from Sigma Aldrich.
Design and construction of protein expression vectors
HER2 has shown low purification yields in insect cells as noted in Results. To alleviate possible causes of weak expression in P. pastoris, the genes of HER2 (residues 691-1255) and hVLK were codon-optimized for P. pastoris and ordered from Genscript Inc. The genes encoding the full-length AurKA, CDK4, CDK6, MKK3 and G1/S-specific cyclin (CycD2) were described previously (32). Since these kinases were intracellular proteins, we opted for an intracellular expression procedure. All target genes were PCR amplified and cloned using the Gibson assembly method (14); genes were positioned downstream of the methanol- inducible alcohol oxidase promoter of the pPICZ-A vector backbone that carried a zeocin selection marker. Affinity tags were added to all genes to facilitate purification (Table 1, Figure 1). For CDK6 and HER2, expression trials included a fusion construct with the N terminal hVLK (Figure 1). The prepared recombinant reactions were used to transform Top10F’ competent cells, and plasmid DNA was prepared using Zyppy™ Plasmid Midiprep Kit (Zymo Research) following manufacturer’s protocol and sent for sequencing (Elim Biopharm) to confirm the constructs.
P. pastoris host strain for expression
The host for protein expression was derived from the protease-deficient strain SMD1163 (his4, pep4, prb1). The newly engineered strain, denoted SMD1163H (pep4, prb1; Mut+), was obtained by transforming the SMD1163 host with the pPIC3.5K plasmid (AddGene plasmid #18707), which was linearized with SacI overnight. Transformation was performed as detailed in the “Transformation of P. pastoris expression host” section, below. pPIC3.5K was added to improve growth rates and to enable cells to grow in absence of histidine in the growth media. Similar results would be expected from the commercially available SMD1168H strain (Invitrogen).
Transformation of P. pastoris expression hosts
P. pastoris electroporation-competent cells were prepared with a high-efficiency transformation protocol (33). The transformation of host cells was carried out using the pPICZ-A plasmids containing the kinase constructs linearized with PmeI to facilitate transformation. Twenty to thirty μg of linearized plasmid was transferred to a pre-chilled 0.2 cm electroporation cuvette, mixed with 40 μl competent cells, and incubated on ice for 5 minutes. Electroporation was conducted on a Bio-Rad Gene Pulser II electroporator with pre-set parameters for P. pastoris (2000V, 200Ω, 25µF). After electroporation, cells were resuspended in a mixture of 1 ml of 1 M sorbitol and yeast extract peptone dextrose (YPD) and were allowed to recover at 30°C for 1.5 hours. Two hundred μl of the mixture was plated on a YPD-Sorbitol (YPDS) plate with 0.5 mg/ml Zeocin. The plates were incubated at 30°C without light for 3 days, until colonies appeared.
To select for multi-copy inserts, we employed the post-transformation vector amplification (PTVA) method (34). Briefly, all colonies from the YPDS plate containing 0.5 mg/ml zeocin were scraped, pooled in 1 ml sterile water, and further diluted into 10 ml sterile water. One hundred and fifty μl diluted suspension was plated on a fresh YPDS plate with 1 mg/ml zeocin. The plate was incubated without light for another 3 days until colonies appeared. If more than 100 colonies were obtained, the process was repeated with 2 mg/ml zeocin until the number of colonies was between 10 and 20. The number of copies of the gene was not determined.
Antibodies and Western blotting
For electrophoretic gel separation, samples were collected and diluted as indicated in each figure, Protein samples were then denatured by boiling in 6X Laemmli sample buffer and run on 4-12% denaturing polyacrylamide gel. For Western analysis, preassembled iBlot® Gel Transfer Stacks were used to transfer proteins from gels to PVDF membranes using the default P3 preprogrammed run (20 V for 7 minutes). Western blots were carried out on the iBind™ Flex system (Invitrogen) per the manufacturer’s protocols. Briefly, membranes were equilibrated with 1X iBind™ Flex Solution, Flex cards were wetted and the primary and secondary antibodies diluted per manufactures’ recommendations. The antibodies and wash solutions were placed in the appropriate wells and the immunostaining proceeded for 2.5 hours as recommended by the manufacturer. The target proteins were probed with anti-kinase antibodies and/or anti-tag antibodies as indicated in each figure. The antibodies were purchased from Cell Signaling (CDK4 (DCS156) #2906, CDK6 (DCS83) #3136) Santa Cruz Biotechnology (CycD2 (B-6) #sc-376676), Millipore Sigma (Strep-Tag II HRP Conjugate #71591-3, HER2 (24B5) #04-291, AurKA (35C1) # A1231). Primary untagged antibodies were further probed with a secondary anti-mouse HRP-linked Antibody (Cell signaling #7076). Chemiluminescence detection was done using Thermo Scientific™ Pierce™ ECL Western Blotting Substrate per the manufacturer’s protocol.
Expression of kinase targets in P. pastoris
Positive transformants were picked and colony PCR was performed using standard AOX sequencing primers (Forward: GACTGGTTCCAATTGACAAGC, Reverse: GCAAATGGCATTCTGACATCC). After confirmation of gene integration into the yeast genome, single transformed colonies were screened for target protein expression by inoculation in 5 ml BMGY and overnight growth. Cells were then pelleted, washed, and resuspended in 5 ml BMMY with 0.5% methanol and grown for 48 hours at 28°C for protein production; 0.5% methanol was replenished after 24 hours. Aliquots were collected at 24 and 48 hrs to measure biomass and protein production levels in order to assess toxicity and optimal incubation time for protein production. Proteins were then isolated by alkaline extraction by incubating cells for 10 minutes in 0.1 M NaOH, pelleting and resuspending in Laemmli sample buffer and separated by gel electrophoresis. Samples were electrotransfered to PVDF membrane using an iBlot™ system and analyzed by Western blot (iBind™ system, Invitrogen) per the manufacturer’s protocols (see above). The transformant with the highest expression level was chosen for large-scale 1 liter culture protein production.
Protein production and purification
All kinases reported in this study were expressed on a 1-liter scale under the same conditions. A single colony from the highest expressing transformant of each target kinase was used to inoculate 20 ml of BMGY medium. This culture was incubated with vigorous shaking at 30°C for 16-18 hours. Cells were pelleted, washed, and resuspended in 500 ml BMMY medium and grown for 48 hours at 28°C for protein production. Cells were then harvested, resuspended in Buffer A (100 mM Tris HCl pH8, 150 mM NaCl, 10% glycerol, 1 mM TCEP, 0.01% Tween) freshly supplemented with 2 mM PMSF and protease inhibitor cocktail tablet and lysed in a Bead-beater (SPEC) following the manufacturer’s instructions. The cell lysate was clarified by centrifuging at 21000 rpm for 1 hour. The supernatant was filtered through a 2-μm prefilter and a 0.45-μm filter then loaded onto an ÄKTA FPLC system with 3x5 ml StrepTrap columns that had been equilibrated with Buffer A. After loading, the columns were further washed with 3 column volumes of Buffer A. The protein was eluted with 3 column volumes of Buffer B (Buffer A supplemented with 5 mM D-desthiobiotin). The eluent was pooled, concentrated and buffer exchanged (Amicon Ultra Centrifugal Filters) into 20 mM Tris HCl pH 8, 75 mM NaCl, 2% glycerol and 1 mM TCEP. The concentration, purity and identity of target proteins in the eluted fractions were estimated by measuring OD280, SDS-PAGE with Coomassie staining, and Western blots, respectively.
MKK3 purified from the StrepTrap column was subjected to a second purification step on gel filtration to separate the monomeric protein form. The eluent from the first purification was pooled, diluted in buffer (50 mM Tris HCl pH8.5, 150 mM NaCl, 5% glycerol and 1 mM TCEP) and injected onto a gel filtration column (HiLoad 16/60 Superdex 200).
To remove the His10-VLK tag from CDK6, the eluent from StrepTrap column was pooled, diluted 10-fold in buffer (50 mM Tris HCl pH8, 300 mM NaCl, 10% glycerol and 1 mM TCEP) and injected to an equilibrated 5 ml HisTrap column. After washing three times with increasing imidazole concentration (20 - 80 mM), the protein was eluted using 250 mM imidazole with improved purity. The eluent was pooled and incubated overnight with in-house purified TEV protease to cleave the His10-VLK portion, then passaged over a 1 ml His resin gravity column to elute CDK6-Strep in the flow through.
Expression in SF9 insect cells
Expression in SF9 cells was done using Bac-to-Bac expression system (Gibco BRL) as detailed in the manufacture’s protocol and in previous publications (21, 35). Cells were harvested and lysed using a microfluidizer in lysis buffer (25 mM Tris (pH 8.0), 10 mM NaCl, 5% glycerol, 10 mM imidazole, 3 mM β-mercaptoethanol) freshly supplemented with protease inhibitor cocktail tablet. Five ml HisTrap column equilibrated with the same buffer was used for the purification and elution was done using an imidazole gradient (20–250 mM).
Protein activity assay
Kinase specific activity was measured using the ADP-Glo Max assay protocol. Briefly, 5 µl of the primary kinase reaction was prepared in a 384-well plate by adding 2 µl of a series of concentrations of the kinases (50 – 400 ng final protein) in 1X kinase buffer (Cell Signaling), 2 µl of 250 µM high purity ATP mixed with the appropriate substrate and 1 µl of 5X kinase buffer. The substrates were purchased from SignalChem and included: 0.5 µg/µl peptide substrate (AAEEIYAARRG) for HER2 constructs, 0.1 µg/µl Retinoblastoma protein (Rb) for CDK4-CycD2 and CDK6-CycD2 complexes, and 0.1 µg/µl Myelin Basic Protein (MBP) for AurKA. Activity of MKK3 was measured indirectly by using MKK3 to activate 0.2 µg/µl inactive p38γ (Thermo Scientific). Two µl of this reaction mixture was added to 1 µl of 5X kinase buffer and 2 µl of 250 µM high purity ATP, mixed with 0.1 µg/µl MBP. Reactions were allowed to proceed for 45 min at room temperature, then 5 µl ADP-Glo Reagent was added and incubated for 40 minutes to terminate the reaction and deplete the unconsumed ATP. Finally, 10 µl of ADP-Glo Max Detection Reagent was added and incubated for 60 min. The resulting luminescence was detected using a Tecan Infinite F200 PRO multimode plate reader. A calibration curve was constructed with high purity ATP/ADP mixtures to quantify the ADP produced in the kinase reaction. The specific activity of each kinase was calculated by dividing the number of moles of ADP produced by the reaction time in minutes multiplied by the enzyme amount in mg. The resulting activity was compared when possible to the reported activity of commercially available kinases.