Cell cultures
Human breast cancer cell lines MCF7 and MDA-MB-231, glioblastoma LN229, human astroglia SVGp12, mouse embryonic fibroblast line MEF, and mouse melanoma cell line B16, were purchased from ATCC and maintained in Dulbeco modified Eagle’s medium (DMEM) (Sigma) supplemented with 10% (v/v) fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin.
RNA interference
The siRNA specific to the human eEF2 and mouse eEF2, and the scrambled siRNA were prepared by Dharmacon. The following specific double strands were used: human, 5'-GGUGUUUGAUGCGAUCAUGAAUUTC-3' (sense), 5'-GAAAUUCAUGAUCGC AUCAAACACCUU-3' (anti-sense); mouse, 5'-GGUGU UUGAUGCGAUCAUGAAUUTC-3' (sense), 5'-GAAAUUCA UGAUCGCAUCAAACACC UU-3' (antisense). siRNAs were introduced into cells using RNAi MAX (Invitrogen) according to the manufacturer’s protocol.
Construction of plasmids
To construct eEF2 plasmids, the cDNAs were synthesized from total RNA (4 μg) of MCF10A cells, using the Super Script IV reverse transcriptase (Life Technologies). The human eEF2 gene was delivered to pcDNA3.1 His6C vector, using BamHI and XhoI restriction enzyme site. The domains of the GTP binding motifs were analyzed using Uniport analyzer (https://www.uniprot.org/uniprot/P13639). The following primers were used: human eEF2, forward: 5’-GACGGATCCGCCACCATGGTGAACTTCACGGTAG-3’; reverse: 5’- ACCTCGA GCGGCTACAATTTGTCCAGGAAGTTG-3’. eEF2 GTP binding motif mutant (CATCAACCT CATTGACTCCCCCGGGCATGTCGACTTCTCCT): forward: 5’-CATCAACCTCATTGTCGAC TTCTCCTCG-3’; reverse: 5’-CGAGGAGAAGTCGACAATGAGGTTGATG-3’. To produce eEF2-GST fusion protein, the vectors of eEF2 and eEF2 GTP binding mutant were digested by BamHI and XhoI and subcloned into pGEX-4T-2 vector. To produce Drp1-GST fusion protein, the human Drp1 gene from pGW1-Drp 20 was amplified by PCR using the following primers; forward: 5’-TTTGGATCCATGGAGGCGCTAATTCC-3’ and reverse: 5’-TTTCTCGAGTCACC AAAGATGAGTCTCCC-3’ and then cloned into pGEX-4T-2 vector.
The plasmid of eEF2 RNAi-resistant mutant was prepared using two-step PCR techniques as previously reported. 21 Briefly, the construct was amplified using the following primers: 5’- AAGGTGTTTGATGCGATCATGAACTTTAAAAAAGAGGA-3’ (forward) and 5’- TCCTCTTTT TTAAAGTTCATGATCGCATCAAACACCTT-3’ (reverse). Three nucleotides in the target sequence of siRNA were changed, and the resultant human eEF2 cDNAs was then subcloned into pcDNA3.1-His 6C vector. In this RNAi-resistant mutant, the target sequence, GAATTTCAAGAAA, was mutated with 3 synonymous, single nucleotide polymorphisms to the following sequence: GAAAACTTTAAAAAA.
Isolation of mitochondria
Cells were suspended in mitochondria isolation buffer (250 mM sucrose, 0.1 mM EDTA, and 2 mM HEPES, pH 7.4) containing protease inhibitors and phosphatase inhibitors (Thermo Scientific) and homogenized using 21G needle. The homogenized cells were then centrifuged at 3,000 rpm for 10 min at 4 °C. The mitochondria-containing supernatants were transferred to new tubes and centrifuged at 15,000 rpm for 30 min at 4 °C. After centrifugation, the pellets (mitochondrial fraction) were lysed with laemmli sample buffer (Bio-Rad).
Measurement of mitochondria length
Cells plated ion 12 mm coverslips were incubated with 0.5 μM Mitotracker Red (Invitrogen) at 37 °C for 30 min, and then fixed with 4 % formaldehyde. The stained cells were mounted on glass slides using CYTOSEAL 60 mounting medium (Thermo Scientific). MitoTracker Red intensity was observed at 581 nm (excitation) using a laser scanning confocal microscope (Nikon). Quantification of the mitochondria length was performed on least 5 images using NIS-elements AR Analysis software (Nikon).
Western blot
Cell lysates were sonicated using Virsonic 100 (1-3 watts) for 5 seconds, and then centrifuged at 15000 rpm for 20 min at 4 °C. Protein amounts were measured using a BCA protein assay kit (Pierce). The proteins (25 μg) were separated by SDS-PAGE, and then transferred onto PVDF membrane. The membranes were incubated with primary antibodies for overnight in 5 % BSA at 4 °C, followed by incubation with a secondary antibody for 2 hrs at room temperature. A femto-chemiluminescence kit (Thermo Fisher Scientific) was used for visualization of the signal. Western blots were analyzed using Image Lab software (Bio-Rad). The antibodies for eEF2 (rabbit), phospho-eEF2 (T65) (rabbit), eEF2K (rabbit), Drp1 (rabbit), SOD2 (rabbit), HA tag (mouse), and prohibitin 1 (PHB1, rabbit) were purchased from Cell signaling. GAPDH antibody (mouse) was purchased from Santa Cruz biotechnologies. 6 X His antibody (mouse) was purchased from Clontech.
Immunoprecipitation
HEK293 cells were transfected with pcDNA, pcDNA eEF2, pcDNA eEF2 GTP mutant, and pGW1-Drp1 using lipofectamin 3000 reagent (Invitrogen) for 3 days according to the manufacturer’s protocol. The eEF2 and Drp1 antibodies were conjugated with protein A/G agarose bead for overnight at 4 °C. Anti-IgG (Rabbit) used as a control (Santa Cruz biotechnologies). The beads were washed three time in ice cold 1X TBST and incubated with 500 μg whole cell extracts of pcDNA, eEF2, eEF2 GTP mutant, and Drp1 for 24hrs at 4 °C. After washing by 1X TBST three times, antibody-conjugated proteins were retained from the beads using SDS-sample buffer (Bio-Rad) and were analyzed by western blot.
GST pull-down assay
The plasmids of human GST-eEF2, GST-eEF2 GTP mutant and GST-Drp1 were constructed as described above, and the fusion proteins of GST-eEF2, GST-eEF2 GTP mutant and GST-Drp1 were prepared as previously described. 22 The fusion proteins (500 μg) were incubated with GST-magnetic beads (50 μl) for 24 hours at 4 °C. After washing with 1X PBST, the GST fusion protein-conjugated beads were incubated with the extracts of HEK 293 cells transfected with eEF2 or eEF2 GTP mutant, and Drp1, for another 24 hours. The proteins retained on the beads were examined by western blot.
Immunofluorescence microscopy
Cells plated on cover slides were first incubated with 0.5 μM Mitotracker Red (Invitrogen) at 37 °C for 30 min, and then fixed with 4 % formaldehyde. Following treatment with blocking buffer, the cells were incubated with an eEF2 antibody at 4°C for overnight, followed by incubation with the second antibodies, AX568 Fluor Red and Alexa Fluor 488 Green, at room temperature for 90 min. Finally, the sample slides were mounted with ProLong Gold Antifade Reagent (Life Technologies) with or without DAPI and incubated overnight at room temperature. The slides were observed using a laser scanning confocal microscope (Nikon).
Electron microscopy
Cells were harvested by trypsinization, and then fixed and embedded in spur resin. Ninety nm- thin sections of cell pellets were cut and examined at 80 Kv with a JEOL 1200 EX transmission electron microscope.
Oxygen consumption rate (OCR)
Oxygen consumption rate (OCR) was measured using the XFe96 analyzer (Agilent Technologies). Briefly, cells (4 X 104 cells) were plated into wells of an XFe96 cell culture microplate and incubated at 37 ⁰C in a CO2 incubator for 24 hours. The assay was started after cells were equilibrated for 1 hour in XF assay medium supplemented with 10 mM glucose, 1 mM sodium pyruvate and 2 mM glutamine. OCR activity was monitored through sequential injections of 1 µM oligomycin, 0.6 μM FCCP, and 1 μM rotenone/ antimycin A to calculate basal, coupled, maximal respiration and spare respiratory capacity. Each plotted value was normalized either to cell counts. Agilent Seahorse XF Analyzer measures oxygen consumption rate (OCR) at intervals of approximately 5-8 min. OCR data were evaluated using 8 individual well values.
Drp1 GTPase assay
The plasmids of pGEX-4T-2/eEF2, pGEX-4T-2/eEF2 GTP binding mutant and pGEX-4T-2/Drp1 were conditionally expressed in Stbl3 E. coli cells with 200 mM of isopropylthio-β-galactoside (IPTG) for 4 hours. Then, the cells were centrifuged at 5,000 rpm for 30 min, and the pelleted cells were suspended in nucleotide and phosphate free solution (20 mM Tris-Cl pH 7.5 and 0.01 % Triton X-100) and sonicated. After sonication, the cell lysates were centrifuged at 15,000 rpm for 30 min. The cell extracts were incubated with 50 μl of GST-magnetic bead for 24 hours on an orbital shaker at 4 °C. The GST-fusion proteins were eluted using 50 μl of elution buffer (50 mM Tris-Cl (pH 8.8), 15 mM glutathione and 1 mM EDTA). The purified proteins, Drp1 and eEF2 or Drp1 and eEF2 GTP deletion mutant, were mixed (vol:vol: 1 : 1= 2 μg : 2 μg) for GTPase assay. The GTPase activity of Drp1 was measured using the colorimetric GTPase activity assay kit (Sigma) following the manufacture’s protocol.
Statistical analysis
All experiments were performed in triplicates and each experiment was repeated at least three times. The data shown were the mean ± standard deviation (S.D.) of a representative experiment. Student’s t - test was used to analyze the difference between two means. The difference was considered significant when the p values: *, p < 0.05; **, p < 0.01; ***, p < 0.001.