Patient specimens collection and ethics statement
CRC and adjacent normal tissue samples were collected from surgical specimens of CRC patients at the Affiliated Cancer Hospital of Nanjing Medical University (Nanjing, China). None of the patients had received chemotherapy, radiotherapy, and targeted therapy before tissue collection. The CRC diagnosis was confirmed by clinical criteria and pathological analysis. Informed consent was obtained from all subjects. All study protocols were approved by the Ethics Committee of Affiliated Cancer Hospital of Nanjing Medical University, China.
Aldolase activity assay
ALDOA activity of CRC specimens was measured using the Aldolase Activity Colorimetric Assay Kit (cat. no. K665-100, BioVision, Tucson, USA) according to the manufacturer’s protocol. A total of 10 mg of CRC tissue samples were rapidly homogenized in 100 µL of ice-cold Aldolase Assay Buffer and kept on ice for 10 min. After centrifuging at 10,000 g for 5 min, 5 µL of sample supernatant and 50 µL of reaction mix were added to a 96-well plate. The absorbance (450 nm) was then immediately measured in kinetic mode for 45 min at 37 °C. One unit of Aldolase was the amount of enzyme that generated 1 µmol of Nicotinamide adenine dinucleotide (NADH) per minute at pH 7.2 and 37 °C.
Cell lines and culture conditions
A total of five human CRC cell lines (DLD1, SW480, SW620, HCT116 and LoVo) and human normal colon epithelial cell line HCoEpiC used in this study were purchased from the American Type Culture Collection (ATCC). All cells lines were cultured in Dulbecco's Modified Eagle Medium (DMEM, KeyGEN BioTECH, Jiangsu, China) containing 10% fetal bovine serum (FBS, Gibco, Thermo Fisher Scientific, Inc. Waltham, USA), 100 U/mL penicillin, 100 μg/mL streptomycin (Invitrogen, Thermo Fisher Scientific, Inc. Waltham, USA), and maintained in 37 °C incubators with 5% CO2.
RNA extraction and qRT-PCR analysis
Total RNA samples were extracted from tissues or cultured cells using TRIZOL reagent (Invitrogen, Thermo Fisher Scientific, Inc.). The cDNA samples were synthesized using the Reverse Transcription Kit (TaKaRa, Tokyo, Japan) according to the manufacturer’s guidelines. Quantitative real-time PCR (qRT-PCR) was used to detect the related genes using PowerUp SYBR Green Mix (Invitrogen, Thermo Fisher Scientific, Inc.). The 20-µL reaction system consisted of 10 µL of SYBR Green Mix, 1 µL each of forward and reverse primers, 2 µL of cDNA, and 6 µL of double distilled water. Relative RNA expression was normalized to that of GAPDH. All qRT-PCR assays were performed in triplicate on ABI 7500 Fast Instrument (model 7300, Applied Biosystems, Thermo Fisher Scientific, Inc.). The primers were synthesized by Sangon Biotech (Shanghai, China). The primer sequences were as follows: ALDOA-F 5’ GGTGCTGGCTGCTGTCTACAAG 3’, ALDOA-R 5’ GACGCCTCCTCCTCACTCTGG 3’, ALDOB-F 5’ AAGGCCCTGAATGACCATCA 3’, ALDOB-R 5’ GCATTGAGGTTGAGAGTGGC 3’, ALDOC-F 5’ AACCTCAATGCCATCAACCG 3’, ALDOC-R 5’ GCTCCACCATCTTCTCCACT 3’, COPS6-F 5’ ACCCTATGACCAAGCACACA 3’, COPS6-R 5’ TGCTATCAGGTGTTCAGCCA 3’, GAPDH-F 5’ GGATTTGGTCGTATTGGGCG 3’, and GAPDH-R 5’ ATCGCCCCACTTGATTTTGG 3’.
Western blotting analysis and antibodies
Protein samples were extracted from cells or tissues in RIPA lysis buffer (Invitrogen, Thermo Fisher Scientific, Inc.) containing a protease and phosphatase inhibitor cocktail (New Cell & Molecular Biotech Co., Ltd, Suzhou, China). The amount of protein was quantified using the BCA Protein Assay Kit (Beyotime Biotechnology, Shanghai, China) according to the manufacturer's instructions. The protein extracts were then separated using 4%–12% gradient sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA), which were blocked with QuickBlock Blocking Buffer (Beyotime Biotechnology), and then incubated with primary and secondary antibodies. Protein bands were visualized using an ECL chemiluminescence reagent (New Cell & Molecular Biotech Co., Ltd) and an Odyssey imaging system (LI-COR Biosciences). Protein levels were normalized using Tubulin (rabbit polyclonal, cat. no. 11224-1-AP, 1:2000 dilution, ProteinTech Group, Wuhan, China). The following antibodies were used: ALDOA (mouse monoclonal, cat. no. sc-390733, 1:1000 dilution, Santa Cruz, California, USA), HRP-Conjugated DYKDDDDK Tag (monoclonal, cat. no. HRP-66008, 1:5000 dilution, ProteinTech Group), E-cadherin (rabbit monoclonal, cat. no. 3195, 1:1000 dilution, Cell Signaling Technology, Boston,USA), N-cadherin (rabbit monoclonal, cat. no. 13116, 1:1000 dilution, Cell Signaling Technology), vimentin (rabbit monoclonal, cat. no. 5741, 1:1000 dilution, Cell Signaling Technology), p38 (rabbit monoclonal, cat. no. 8690, 1:1000 dilution, Cell Signaling Technology), p-p38 (rabbit monoclonal, cat. no. 8632, 1:1000 dilution, Cell Signaling Technology), ERK1/2 (rabbit monoclonal, cat. no. 4695, 1:1000 dilution, Cell Signaling Technology), p-ERK1/2 (rabbit monoclonal, cat. no. 4376, 1:1000 dilution, Cell Signaling Technology), ACTB (rabbit monoclonal, cat. no. AC038, 1:10000 dilution, ABclonal Technology, Wuhan, China), GAPDH (rabbit monoclonal, cat. no.60004-1-Ig, 1:10000 dilution, ProteinTech Group), Lamin B1 (rabbit polyclonal, cat. no. 12987-1-AP, 1:2000 dilution, ProteinTech Group), PKM (rabbit polyclonal, cat. no. 10078-2-AP, 1:1000 dilution, ProteinTech Group), HSP90AB (rabbit polyclonal, cat. no. RK05737, 1:1000 dilution, ABclonal Technology), and CSN6 (mouse monoclonal, cat. no. sc-393023, 1:1000 dilution, Santa Cruz, California, USA).
Immunofluorescence
For immunofluorescence (IF) testing, the cells were fixed with 4% paraformaldehyde for 10 min and then permeabilized with Triton X-100 for 15 min. ALDOA antibody (rabbit polyclonal, cat. no. A1142, 1:100 dilution, ABclonal Technology) was used for IF incubation, while 4,6-diamidino-2-phenylindole (Beyotime Biotechnology) was added for cell nuclei staining. The fluorescent images were then captured under a fluorescence microscope (Olympus Corporation, Tokyo , Japan).
Transfection of CRC cells
Two individual ALDOA and one universal negative control small interfering RNA (siRNA) samples were purchased from RiboBio. The pcDNA3.1(+)-ALDOA overexpression plasmid was purchased from Public Protein/Plasmid Library (Jiangsu, China). The pcDNA3.1(+) empty vector was extracted using Endofree Plasmid Maxi Kit (Qiagen, Germany). The plasmid DNA or siRNAs were transiently transfected into CRC cells using Lipofectamine 3000 (Invitrogen, Thermo Fisher Scientific, Inc.) following the manufacturer's protocol.
Construction of stable ALDOA knockdown or overexpression cell lines
Lentiviral particles underexpressing or overexpressing ALDOA, both tagged with Green fluorescent protein (GFP), were purchased from Corues Biotechnology (Jiangsu, China). FLAG-tag was added to ALDOA-overexpressing lentiviral particles as well. These lentiviral particles were individually used to infect SW480 and DLD1 to generate the corresponding stable cell lines after purine screening for one week. The scrambled shRNA or empty vector transfected cells were established as matched controls. The efficiency of ALDOA knockdown or overexpression was assessed using western blot and qRT-PCR assays.
Cell proliferation assay
The cells were seeded in 96-well plates at a density of 3000 cells per well. Cell viability was evaluated using Cell Counting Kit-8 (CCK-8, Dojindo Laboratories, Tokyo, Japan) daily for three days. Then, 10% CCK-8 solution was added to each well, and the cells were incubated for 1 h. The absorbance was measured at a wavelength of 450 nm on SpectraMax (Molecular Devices).
Wound healing assay
The cells were cultured in six-well plates at a density of 5 × 105 cells/mL. After becoming confluent, the cells in the six-well plates were carefully scratched using 10-µL sterile tips to form cell-free linear regions. The supernatant was then discarded after washing with phosphate buffer saline (KeyGEN BioTECH). The images were acquired using an inverted light microscope. Cell mobility was quantified by calculating the area of wound closure.
Migration and invasion transwell assay
Cell invasion assays were performed using Transwell chambers (Corning, New York, USA) precoated with Matrigel (BD Biocoat, Corning), while cell migration assays were completed without Matrigel. A total of 40,000 cells in 200 μL of serum-free medium were seeded in the top chambers, while the lower chambers contained DMEM with 20% FBS. After 48 h of incubation at 37 °C, the cells migrated or invaded into the lower surface were fixed with 4% paraformaldehyde (Beyotime Biotechnology) and visualized using crystal violet staining (Beyotime Biotechnology). The images of cells were captured at 20× using a light microscope and three random fields were counted in each chamber. Three independent experiments were performed.
Immunoprecipitation assay and mass spectrometry analysis
Immunoprecipitation (IP) assays were performed using the Dynabead Protein G IP Kit (Thermo Fisher Scientific, Inc.) following the manufacturer’s instructions. Anti-FLAG beads (Thermo Fisher Scientific, Inc.), stable ALDOA overexpression cell lines tagged with FLAG and their control cells, anti-ALDOA antibody (mouse monoclonal, cat. no. sc-390733, Santa Cruz, California, USA) and anti-COPS6 antibody (mouse monoclonal, cat. no. sc-393023, Santa Cruz, California, USA) were used in the IP assay. After the IP assay, 10% SDS-PAGE gel electrophoresis was performed and a silver stain was applied using the Fast Silver Stain Kit (Beyotime Biotechnology) following the manufacturer’s instructions. Proteins contained in the specific silver staining bands were identified using mass spectrometry (MS).
Mouse xenograft assay
Female BALB/c nude mice (4–6 weeks old) were purchased from Charles River Laboratory for CRC cell xenograft assay. A total of 12 nude mice were randomly assigned into two groups (ALDOA knockdown and control groups). A total of 6×106 cells (150 μL) from each group were subcutaneously injected into the side of each nude mouse. The tumor volumes and body weight of nude mice were observed and monitored every three days. The tumor volume was calculated using the following formula: volume (cm3)=(length×width2)/2. After 30 days, the nude mice were placed into a container (clean and no CO2 prefilling) for euthanasia. Then, 100% CO2 was introduced into the container using compressed CO2 gas cylinder with a CO2 flow controller. The flow rate was 10-30% of the container volume per minute (1.25-3.75 L/min). The CO2 exposure time was 2-3 min. After confirming that the nude mice were unconscious, on breathing, no heartbeat, and dilated pupils, the CO2 valve was closed, followed by observation for 2 min to ensure that the nude mice were dead. The tumors were immediately collected and measured, followed by hematoxylin-eosin (HE) staining and ki-67 detection (rabbit polyclonal, cat. no. 27309-1-AP, 1:8000 dilution, Proteintech Group). All animal experiments were approved by the Institutional Animal Care and Use Committee of Nanjing Medical University, Nanjing, China (No. 2006034).
Statiatical analysis
Data that were independently collected in triplicate are presented as means ± standard deviation. All data were evaluated using one-way analysis of variance and Student’s t-test with GraphPad Prism 7.0 software (GraphPad Software, Inc.). A P-value of <0.05 was considered statistically significant.