Preparation of protein, ligand and molecular docking study
The 3D X-ray crystallographic structures of sterol 14-alpha demethylase enzyme (CYP51, PDB code: 5TZ1) was retrieved from RCSB database (Hargrove et al. 2017). The structure of thidiazuron (PubChem CID: 40087) used in this study was retrieved from pubchem database (https://pubchem.ncbi.nlm.nih.gov/compound/) as .sdf format and latter converted to .pdb format using PyMOL software. Docking calculations were executed using AutoDock (version 1.5.2 revision 2) as described in the literature (Morris et al. 2009; Emeka et al. 2020). The docked conformations of each ligand were ranked into clusters based on the binding energy and the top ranked conformations were visually analyzed with PyMOL software.
Chemicals, microbial strains and culture conditions:
C. albicans strain MTCC 183 obtained from the Institute of Microbial Technology, Chandigarh, India were cultured in sabouraud dextrose broth (SDB) (1% yeast extract, 1% peptone, 4% glucose, 1% agar) and maintained at 4 °C. Standard cell suspensions were prepared by inoculating single colony of C. albicans in tryptone soya broth (TSB) medium containing 1% glucose and overnight incubation at 37 °C at 200 rpm in a shaker. Thidiazuron (TDZ) extrapure, 97% was purchased from Sisco research laboratories (SRL, Chennai, India). Unless indicated all the chemicals and media used in the present study were purchased from Himedia (Mumbai, India).
Antifungal Activity of thidiazuron:
Overnight grown fungal cells were collected by centrifugation and subsequently washed in phosphate- buffered saline (PBS) and resuspended to 1 × 106 CFU/mL using TSB medium with 1% glucose. Antifungal activity of thidiazuron (200 to 25μM) and fluconazole (25 μg) were screened using disk diffusion method in Mueller-Hinton agar. In brief, Mueller-Hinton agar was spread with C. albicans (1 × 106 CFU/mL) and the disk containing test antifungal agent was placed and subsequently incubated for 24 to 48 h at 37 °C. The results were interpreted based on measuring the diameter of the zone of inhibition.
Planktonic minimal inhibitory concentration (PMIC)
The minimal inhibitory concentration (MIC) values of planktonic suspending cells for C. albicans was determined in microtitre plates by broth micro-dilution according to the clinical and laboratory standards institute guidelines, document M27-S4 (Clinical and Laboratory Standards Institute [CLSI] 2008). Plates were prepared under aseptic conditions. To each well, 100 μL of thidiazuron (200µM) and fluconazole (100 µg/mL) in 10% (v/v) DMSO or sterile water was pipetted into the first row of the plate and serially diluted. Finally, 10 μL of fungal suspension (1 × 106 CFU/mL) was added to each well and incubated for 24 h at 37 °C. After incubation, 30 µL of resarzurin (0.015%) was added to each well and further incubated for 2-4 h for the observation of color change (Menon et al. 2012). Plate absorbance was then read at 570 nm and concentration of thidiazuron/fluconazole that inhibited 50% of cell growth was defined as PMIC.
Scanning electron microscopy (SEM) analysis
Planktonic cells of C. albicans (1 x 106 CFU/mL) were prepared in 2mL of SDB broth, to which thidiazuron and fluconazole at 1X PMIC50 were treated and incubated for 24 h at 37 °C. Immediately after incubation, the cells were harvested by centrifugation and washed twice with sterile PBS. Immediately, the samples were dehydrated for 5 minutes with series of increasing concentration of ethanol (50, 70, 90, and twice at 100%). The dehydrated samples were placed overnight in a vacuum oven at 25 °C, then sputter-coated with gold, scanned and imaged using JEOL High Resolution Scanning Electron Microscope (HRSEM) (Thermoscientific Apreo S, Netherlands).
Time-Kill Assay for C. albicans towards thidiazuron
The time kill assay of C. albicans towards thidiazuron was performed as described earlier(Ali et al. 2010). A cell suspension of C. albicans (1 x 106 CFU/mL) was prepared in tubes containing 8 mL of SDB broth, to which different MIC folds of thidiazuron (0.5, 1, 2, 4 and 8X) were added and appropriate controls were maintained. All tubes were incubated in a shaking incubator at 37 °C for 24 h. Fungal cell suspensions (1 mL) were collected at time intervals of 0, 6, 12, 24, and 48 h, serially diluted in SDB, and then plated out on Sabouraud dextrose agar (SDA). After incubation for 24 h at 37 °C, colony-forming units (CFU) were counted for individual samples and analyzed.
Inhibitory potential of thidiazuron against C. albicans biofilm
The C. albicans biofilm was measured by crystal violet staining and XTT assay. In brief, the cell suspension of C. albicans was determined using a haemocytometer Neubauer improved chamber and adjusted to 1 x 106 CFU/mL in RPMI 1640 medium supplemented with 2% (w/v) glucose. To a 96 well flat bottom cell culture plate 200µl of cell suspension along with various concentration of thidiazuron (100 to 6.25 μM) in RPMI medium was co-incubated for 48 h at 37 °C. Appropriate media and culture controls were also maintained in parallel to the thidiazuron treatment. Later, the supernatant along with suspended planktonic cells were removed and the biofilm was washed twice with sterile PBS. Subsequently, the biofilm in each well was stained with freshly-prepared crystal violet solution (100 µL, 0.1%, w/v) and incubated for 10 min. Then, the unbound stains were removed and the wells were washed with sterile distilled water. Plates were then rocked in 95% ethanol at room temperature for 30 min and absorbance recorded at the wavelength of 595 nm (Emeka et al. 2020).
For XTT assay, the supernatant containing unbound cells and media components was removed from each well, washed twice using sterile PBS and 100 μL of fresh/sterile medium was added to each well. The phenazine methosulfate (PMS) solution was prepared by dissolving 3 mg PMS in 1 mL of 1X PBS. The XTT solution was prepared by dissolving 4 mg XTT in 4 mL of culture medium. Working detection solution was prepared by mixing 10 μL of the PMS solution to the 4 mL of XTT solution. Then immediately, 50 μL of detection solution made in the previous step was added to each well and incubated for 4 h at 37 °C. Plates were kept in a shaker for a short period of time (10 seconds) to mix the dye in the solution and absorbance recorded at 450 nm(Roehm et al. 1991). The percentage of biofilm inhibition was determined according to an earlier study (Subramenium et al. 2018) and 80% inhibition of biofilm formation was considered as minimum biofilm inhibitory concentration (MBIC).
Fluorescent microscopic analysis of biofilm inhibitory activity of thidiazuron
C. albicans biofilms were cultured in a 12 well culture plate with different concentrations of TDZ (0, 6.25, 12.5, 25, 50, 100 μM) in RPMI 1640 medium supplemented with 2% (w/v) glucose for 48 h at 37 °C. The wells were washed trice with sterile PBS to remove unbound cells and stained for 30 min in the dark with acridine orange. Fluorescent microscope (Optika, Germany) was used to record image stacks in five random locations at 40X magnification. In each experiment, the light intensity, background level, and contrast were maintained at the same level.
Ergosterol Biosynthesis assays:
The C. albicans cells (1 x 106 CFU/mL) were inoculated in 50 mL of SDB with TDZ (value µM) or DMSO as the control and incubated in a shaking incubator at 37°C for 18 h. Immediately after incubation, cell biomass centrifuged at 2700 rpm for 5 min, washed and weight of individual pellets were recorded. The pellet in each tube were treated with 3 mL of alcoholic potassium hydroxide solution (25%), vortexed for 1 min and incubated in a water bath at 85°C for 60 min. The tubes were then cooled and sterol extraction was conducted via vortexing the samples in water : n-heptane mixture (1:3) for 3 min. For analysis, 1 mL of sterol extracts with five-fold ethanol (100%) were subjected to scanning between wavelengths of 240 to 300 nm in UV/VIS Spectrophotometer (LABMAN Scientifics, India). The cells treated with fluconazole and DMSO were considered as positive and negative controls respectively. The levels of ergosterol was calculated and expressed as percentage in terms of weight of the pellet using the below equation:

%Ergosterol = %ergosterol+%24(28)DHE−%24(28)DHE,
Where, F - factor for dilution in ethanol; 290 – E value (in percentages per centimetre) determined for crystalline ergosterol; 518 – E values (in percentages per centimetre) determined for 24 (28) DHE.
RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR) based gene expression analysis of biofilm markers
C. albicans (1×106 CFU/mL) were cultured in a 12 well culture plate in RPMI 1640 medium supplemented with 2% (w/v) glucose and allowed for adhesion. The wells with 2 mL of RPMI 1640 medium containing TDZ (µM) or DMSO as the control were then incubated statically at 37°C for 24 h. On completion of incubation period, mycelial samples were collected and frozen in liquid N2, and ground into fine powder. Total RNA extraction was performed according to the standard manufacturer’s protocol using TRIzol reagent (Ambion, USA). For gene expression analysis, reverse transcription was performed using PrimeScript™ 1st strand cDNA Synthesis Kit (TAKARA BIO INC, Japan) following the manufacturer’s instructions. Reverse transcription (RT) reactions contained 3 µg of total RNA samples, 1 µL of random Primer (50 µM), 1 µL of dNTP Mixture (10 mM each), 4 µL of 5X PrimeScript Buffer, 0.5 µL of RNase Inhibitor (40 U/µL), 1 µl of PrimeScript RTase (200 U/µL) and were topped off to 20 µL with Diethylpyrocarbonate (DEPC) treated water. The thermal profile for RT consisted of incubation at 30°C for 10 min, 42°C for 60 min and termination of the reaction at 95°C for 5 min. The quantitative PCR reactions, which were prepared to a final volume of 25 µL, included 12.5 µL of 2 × SYBR® Select Master Mix (Applied Biosystems, USA), 10 µM forward/reverse primers, and 1 µL of undiluted cDNA. Primers used in the present study were shown in Table 1 (Theberge et al. 2013). Quantitative RT PCR was performed using a Rotor-Gene Q 2PLEX HRM Real-Time PCR system (Qiagen, Netherlands). The amplification protocol involved enzyme activation at 50°C for 2 min, denaturation at 95°C for 2 min, followed by 40 cycles at 95°C for 15 s and 60°C for 60 s. Three independent experiments were carried out and each cDNA sample was analyzed in triplicates. The average threshold cycle (CT) values were used to calculate relative expression levels normalized to b-tubulin using the 2∆∆CT method (Livak and Schmittgen, 2001).
Table 1
List of primer sequences for biofilm marker genes used for qRT-PCR.
Gene | Forward primer | Reverse primer | Amplicon size (bp) | Reference |
ALS3 | AATGGTCCTTATGAATCACCATCTACTA | GAGTTTTCATCCATACTTGATTTCACAT | 51 | 24 |
EAP1 | CTGCTCACTCAACTTCAATTGTCG | GAACACATCCACCTTCGGGA | 51 | 24 |
EFG1 | TATGCCCCAGCAAACAACTG | TTGTTGTCCTGCTGTCTGTC | 202 | 24 |
NRG1 | CACCTCACTTGCAACCCC | GCCCTGGAGATGGTCTGA | 198 | 24 |
HWP1 | GCTCAACTTATTGCTATCGCTTATTACA | GACCGTCTACCTGTGGGACAGT | 67 | 24 |
SAP5 | CAGAATTTCCCGTCGATGAGA | CATTGTGCAAAGTAACTGCAACAG | 78 | 24 |
ERG3 | TCCAGTTGATGGGTTCTTCCA | GGACAGTGTGACAAGCGGTA | 179 | This study |
ERG25 | TGCTGCTCCATTTGGATTGG | GGAATGAGCATCAACGGCTT | 175 | This study |
ACT1 | GCTGGTAGAGACTTGACCAACCA | GACAATTTCTCTTTCAGCACTAGTAGTGA | 87 | 24 |
ALS3 - Hyphal-specific Cell wall adhesin; EAP1 - hyphae-specific cell wall adhesin protein; EFG1 - hyphae-specific gene activator; NRG1 – transcriptional repressor of hyphae-specific genes; HWP1 - hyphae-specific cell wall protein; SAP5 - secreted aspartyl proteases; ERG3 - C-5 sterol desaturase; ERG25 - methylsterol monooxygenase and ACT1 - actin related gene 1 |
Statistical analysis
All experiments were performed in triplicates, and the results were expressed as the mean ± standard deviation. Statistical analyses of the differences between the means of two experimental groups were evaluated by an unpaired two-tailed Student’s t-test using GraphPad Prism 5.0 and a p-value of less than 0.05 was considered significant.