Silver diamine fluoride (SDF) used in childhood caries management has potent antifungal activity against oral Candida species

doi:10.21203/rs.2.17219/v1

Download PDF

Research article

Silver diamine fluoride (SDF) used in childhood caries management has potent antifungal activity against oral Candida species

https://doi.org/10.21203/rs.2.17219/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 15 Apr, 2020

Read the published version in BMC Microbiology →

You are reading this older preprint version

Read the latest preprint version →

Background The microbiome of Severe-Early Childhood Caries (S-ECC), is characterized by an ecosystem comprising bacterial and fungal species, with a predominance of Candida species. Hence, an anti-cariogen effective against both bacteria and fungi would be valuable in the management of S-ECC.

Methods Here we evaluate the antifungal effect of silver diamine fluoride (SDF) against 35-clinical yeast isolates (Ten-each of C. albicans , C. krusei, C. tropicalis and five C. glabrata strains) from dentinal caries-lesions from S-ECC.

Results Disc-diffusion and time-kill assays as well as MIC 50 and MIC 90 evaluations against therapeutic concentrations confirmed the broad-spectrum anti-candidal potency of SDF. Ultrastructural images revealed morphologic aberrations of yeast-cell walls on exposure to SDF. All C. krusei and C. glabrata isolates were significantly more sensitive to SDF, relative to the standard antifungal fluconazole.

Conclusions Our data, for the first time, elucidate the antifungal potency of SDF, in addition to its known antibacterial activity, in the management of S-ECC.

Applied & Industrial Microbiology

Candida species

antifungal efficacy

silver diamine fluoride

severe early childhood caries

dentin caries

Dental caries, the most prevalent chronic disease of humans, [1] is a highly dynamic pathological process initiated and perpetuated by a polymicrobial community of organisms residing in plaque biofilms [2]. Despite advances in the understanding and the management of the caries process over the last few decades, little headway has been made to eradicate caries, particularly in underserved populations in the developing world [3–5].

The mutans-group of streptococci is classically considered as prime movers of the caries process. However, in addition to mutans streptococci several clinical studies have now confirmed the high prevalence of the opportunistic fungal pathogen, Candida in plaque-biofilms, particularly in severe early childhood caries (S-ECC) [6–8]. In a recent comprehensive review on S-ECC, Xiao et al. [9] noted the prevalence of C. albicans ranging between 60 to 100% in ECC lesions, and others have shown even higher prevalence frequencies in infected deep dentinal lesions [10].

This curious, interspecies, fungal/bacterial cross-kingdom association of acidogenic and aciduric microbes is likely to be due to a sucrose-rich diet of caries prone individuals, that promotes acidification of the plaque biofilm matrix, leading to accelerated caries progression [2, 11]. In a recent review, Pereira et al. (2018) have made a strong case for a significant role of aciduric/acidophilic and acidogenic fungi such as Candida in caries progression and deep dentinal caries [12]. Indeed, our own data indicate a very high prevalence of yeast species in over 70 percent in a Middle East (Emirati) cohort of patients with S-ECC (Fakhruddin et al. unpublished). Therefore, in clinical terms, an effective monotherapy, targeting both the fungal and the bacterial components of the plaque biofilm is urgently needed to manage caries, particularly ECC.

There is a long history of the use of silver compounds in medicine due to its excellent antimicrobial properties [13, 14]. Silver is a broad-spectrum chemical with excellent anti-biofilm properties, and hence widely integrated into indwelling devices such as orthopedic prostheses, cardiac devices, and surgical instruments [15–17]. In dentistry too the susceptibility of several species of oral microbiota to silver-ions has been reported [18, 19], as a result of which it is now incorporated into some dental materials [20]. The exact mechanisms by which particulate silver kills bacteria and fungi are unclear, but it is known that silver causes microbial death by binding to microbial cell wall and membrane components thus causing toxicity and death of the organisms [21].

Relatively recently, a silver-containing compound, silver diamine fluoride -SDF has been added to the anti-microbial armamentarium of dentistry as an attractive therapeutic agent for arresting and preventing dental caries [22]. Silver- ions released from SDF have shown to inhibit cariogenic bacteria, both in the planktonic (suspended) and the biofilm (sessile) phases of growth [23, 24]. For instance, De Almeida and colleagues (2011) used the agar diffusion method to demonstrate the antibacterial effect of SDF against the cariogen, S. mutans [25], and a few years later, Targino and his team determined the minimal inhibitory concentration (MIC) and minimum bactericidal concentrations (MBC) of SDF for S. mutans [26]. Others too have examined the action of SDF on multispecies bacterial biofilms and reported its high antibacterial activity in such mixed consortia [27, 28]

As far as we are aware there are no studies, to date, in the English language literature assessing the antifungal effect of SDF on Candida isolates from plaque biofilm. Although it is well known that SDF is an efficacious antibacterial, its ability to eradicate co-infecting yeasts within the cariogenic biofilm matrix remains unclear. Hence, in this study we evaluated the antifungal effects of SDF against a broad spectrum of common pathogenic Candida isolates (Candida albicans, C. krusei, and C. tropicalis, and C. glabrata isolates) obtained from children with S-ECC.

The present study was conducted under a protocol approved by the Research Ethics Committee, University of Sharjah (REC–18–02–18–03). Consent to participate in the study was obtained from all the parents/guardians of the minors, who participated in this study.

Yeastisolates: Overall,a total of 85 Candida isolates,obtainedfrom 48-yeast positive samples of carious dentin of children with S-ECC were selected for the current study and comprised ten isolates each of Candida albicans, C. krusei, and C. tropicalis, and five C. glabrata isolates (Fakhruddin et al., manuscript in preparation).

The identity of the isolates was reconfirmed by sub-culture on Sabouraud Dextrose Agar (SDA), and the characteristic growth on CHROMagar (HiCrome™ Candida Differential Agar, M1297A) and finally by multiplex PCR (see below).

Multiplex PCR:

The identity of the isolates were further confirmed by Multiplex PCR amplification method, which permitted the identification of six common pathogenic yeast species, namely C. albicans, C. glabrata, C. parapsilosis, C. tropicalis, C. krusei, and C. dubliniensis. The employed method was based on the amplification of two fragments from the ITS1 and ITS2 regions by the combination of two-yeast-specific and six-species-specific primers in a single PCR reaction [29], Table 1. All PCR-reaction products were evaluated by electrophoresis in 2.0% (w/v) agarose gels run at 90V for 60 mins

Antifungal susceptibility assay by disc diffusion:

The antifungal susceptibility of the yeast was evaluated against amphotericin B, fluconazole, and SDF. To prepare the SDF impregnated discs, stocks of sterile filter paper discs stored at 20⁰C were allowed to reach room temperature, and then infused with SDF volumes of 2.5µl, 5µl, 10µl, and 15µl and dried in an oven for an hour at 60⁰C before use.

To minimize batch to batch variation, plates were prepared on a single session at ambient temperature, with a constant agar volume of Sabouraud Dextrose Agar (SDA; MH063, Himedia).

All isolates of Candida albicans, C. krusei, C. tropicalis and C. glabrata strains were selected randomly and tested by agar-based diffusion test following CLSI M44-A2 standardized method with some modifications [30]. In brief, a yeast cell suspension of 10⁶cells/mL from a 24-hours old culture was grown in Sabouraud Dextrose broth (ME033, Himedia) and adjusted to 0.5 McFarland standard using a densitometer (Grant Instruments™ Grant Bio™ Densitometer) and spread uniformly using a glass spreader.

The inoculated SDA plate was allowed to dry for 20 minutes, followed by application, aseptically, of Amphotericin B–20mcg disks (SD233, AP 20mcg, Himedia), Fluconazole–25mcg disks (SD232, FLC 25mcg, Himedia), sterile paper disks with SDF (Thermo Scientific™ Oxoid™ Blank Antimicrobial Susceptibility Discs) and a sterile paper disc (the negative control) using a pair of forceps. The plates were incubated at 37⁰C within 15–20 mins, after the application of up to a period of 48-hours, before evaluation of zones of growth inhibition. Recommended CLSI quality assurance isolates Candida parapsilosis ATCC 22019 [25] was tested as a positive control, with each set of experiments.

After 48-hours, inhibition zone-diameters were measured to the nearest millimeter at the point where there was a noticeable growth reduction. All experiments were tested in triplicate, on three separate occasions.

Broth microdilution antifungal susceptibility assay:

Minimal inhibitory concentrations (MIC₅₀ and MIC₉₀) for silver diamine fluoride (SDF) was ascertained following standard methodology set out in CLSI M27-A3 broth microdilution procedure, with some modifications [31, 32]. The modifications include using flat-bottom 96-well microtiter plates (Corning, 3370 Polypropylene Flat Bottom 96 Well) and growth reading determined spectrophotometrically by a microplate reader. As brown discoloration of oxidized silver-ions in SDF makes it challenging to evaluate growth in the wells of the microtiter plates visually.

Amphotericin B (AMB, A2942, Sigma-Aldrich) and Fluconazole (FCZ, ≥98% (HPLC), powder F8929 Sigma-Aldrich) was prepared by dissolving AMB in 5% DMSO and FCZ in sterile distilled water. The solutions were added to RPMI–1640 w/ L-glutamine, 0.2% glucose and 0.165 moles/l MOPS buffer w/o sodium bicarbonate (AT180, RPMI–1640, Himedia) during the time of antifungal exposure to Candida spp. Minimum inhibitory effect of AMB and FCZ on clinical isolates were verified over the concentration range of 0.125–64µg and 0.0312–16µg, respectively.

Silver Diamine Fluoride complex (Topamine, 25%w/v of silver ions, Product code: DL160.9–1) was obtained from Dentalife Australia Pty. Ltd. Antifungal effects of Ag+ particles present in SDF volume-range of 0.156µl–15µl were tested over the concentration range between 0.039mg to 3.75mg of silver (0.039 mg; 0.078 mg; 0.156 mg; 0.313 mg; 0.625 mg; 1.25 mg; 2.5 mg; 3.75 mg).

For minimum inhibitory concentration (MIC) determinations, all yeast cell suspensions tested were adjusted to a turbidity of 0.5McFarland standard. Subsequently, the cell suspensions were further diluted to a final concentration of 10³ cells/ml in the RPMI 1640 medium with 2X serial dilutions of Ag+ in SDF, AMB, and FCZ and were pipetted into well of 96-well plates in a standardized manner, and the plates incubated at 37⁰C for 24-hours. Afterwards, the MICs were determined spectrophotometrically at 490nm with a microtiter plate reader (BIO-TEK, ELX800, USA). MIC₅₀ and MIC₉₀ were defined as the lowest drug concentrations that inhibited growth by 50% and 90% compared with drug-free wells, as determined by the absence of turbidity.

In each susceptibility test, QC strain C. parapsilosis ATCC 22019 was included. MIC range of 0.5µg–4µg of FCZ to C. parapsilosis ATCC 22019 was used as a reference.

All tests were replicated on three separate occasions with observations determined independently by two observers.

Time-kill assay:

Time-kill curves were developed using a protocol described by Klepser et al., with some modifications [33]. The test concentrations of Ag+ (0.625mg; 1.25mg; 2.5mg) in SDF volumes of 2.5µl, 5µl and 10µl were assessed at pre-determined time points (0, 30mins, 1hr, 2hrs, 12hrs and 24hrs). A fresh yeast inoculum was prepared for each experiment by harvesting a 24-hour growth in Sabouraud dextrose broth, and yeast suspension adjusted, spectrophotometrically, to 0.5McFarland standard (1x10⁶to 5x10⁶ CFU/ml).

Yeast suspension (1ml) was diluted in 9ml of RPMI 1640 medium with and without SDF, which provides the starting inoculum of 1× 10⁵ to 5×10⁵ CFU/ml. After incubation at 37⁰C with agitation, a 100µl aliquot was removed from each solution at predetermined time points and serially diluted (10-folds) in sterile water. From each dilution, a 30µl aliquot was plated on SDA. Colony counts were subsequently obtained after incubation of the plates at 37°C, at pre-determined time points. The fungicidal effect was defined as ≥99.9%, or 3-log10-unit, reduction in CFU/ml from the starting inoculum [33, 34]. Time-kill experiments were conducted in duplicate on different occasions.

Scanning electron microscopy:

The effects of the SDF on the ultrastructural features of a single strain of C. albicans was investigated using SEM. A randomly selected C. albicans strain was incubated in RPMI 1640 at 37⁰C for 24- hours in a 12-well plate. A yeast suspension of 2.5x10⁵ cells in RPMI was prepared into which 5µl SDF (1.25mg of silver-ions) was added. The morphological changes of the treated yeast cells were observed after 10- minutes, and 1-hour post-SDF treatment. The antifungal concentration of silver-ions was selected based on the results obtained in the susceptibility testing assays.

Standard methodology with minor modifications was used for SEM analysis of yeast as previously described [35]. Samples of the negative control (untreated cells) and treated cells for 10mins and an hour, respectively, were fixed in 2.5% glutaraldehyde and 4% paraformaldehyde in the presence of cacodylate buffer (pH 6.2) on ice for an hour. Post-fixation of the samples was carried out for 30-minutes with 1% osmium tetroxide. Samples were gently dehydrated in graded ethanol (30%, 50%, 70%, and 90%). The treated and control samples were then mounted on aluminum stubs and air dried at room temperature, and sputter coated with gold (Polaron SC7640 sputter coater; Thermo VG Scientiﬁc, United Kingdom) and observed with an environmental scanning electron microscope (FEI Co., Hillsboro, OR).

Finally, Energy Dispersive X-Ray Spectroscopy (EDS) of the Ag⁺ ion deposition was also carried out for the samples exposed to SDF.

Statistical Analysis:

The data obtained from SDF antifungal assays were presented as mean ± standard deviation (SD). MIC₅₀, MIC_90, and means of inhibition-zone diameters were calculated for each Candida strains. The group difference was analyzed using one-way analysis of variance (ANOVA). For all statistical analysis, a P value of ≤0.05 was considered statistically significant.

The effect of SDF on different Candida species

A total of 35 Candida isolates belonging to four different Candida spp, viz. C.albicans (10 strains), C krusei (10), C tropicalis (10)and C glabrata (5)were evaluated for their susceptibility to SDF using the classic, disc diffusion assay. For this purpose filter paper discs impregnated with four different volumes of SDF 2.5µl, 5µl, 10µl, and 15µl were used and the zones of growth inhibition, in terms of the zone-diameters in millimeters, were measured after 48 h.

The growth inhibition zone edges due to SDF diffusion were sharply defined and could be readily determined for all the tested strains. We noted increasing concentration of SDF led to increased inhibitory zone diameters in all four species, implying a dose-response effect of SDF on all four tested Candida species (p <0.001; Fig. 1). Interspecies variations in the susceptibility of the Candida species to SDF was noted with C. tropicalis, being relatively more resistant to SDF, according to the diameter of the inhibitory zone of culture growth.

The relative anti-candidal effect of SDF, Fluconazole and Amphotericin B

We also compared the relative antifungal activity of two commonly used antifungals, fluconazole (25 mcg) and amphotericin B (20 mcg) against four different volumes of SDF (2.5µl, 5µl, 10µl, 15µl) containing viz: 0.625, 1.25, 2,5, and 3.75 mg of Ag⁺. For broth microdilution assay, the antifungal concentrations of fluconazole and amphotericin B were chosen as per the NCCLS guidelines [32]. In general, the anti-candidal activity of SDF was far superior to the polyene - amphotericin B, and the triazole - fluconazole (Figs. 2a-d).

On comparing the relative fungicidal activity of fluconazole (25 mcg) and SDF against the ten isolates of C. tropicalis, only the highest concentration of SDF proved to be significantly superior to fluconazole, while the other four concentrations of SDF showed lower activity than fluconazole (Fig. 2c). On the other extreme, relative to fluconazole, all ten C. krusei isolates and the five C. glabrata were significantly more sensitive to all five concentrations of SDF evaluated (p≤0.05; Figs. 2b and 2d).

When the relative antifungal efficacy of amphotericin B vs. SDF was compared, we noted that virtually all four concentrations of SDF significantly inhibited all four Candida species we evaluated, compared to a standard 20 mcg concentration of amphotericin B (p≤0.05 for all).

Evaluation of minimum inhibitory concentrations (MIC)

At present, there is neither a documented or universally agreed, standard MIC, nor susceptibility range, nor breakpoint sensitivities for Candida species against SDF. In the absence of such information on the relative antifungal efficacy of SDF vs. conventional antifungals (such as fluconazole and amphotericin B) for evaluating MIC. We used the susceptibility range for Amphotericin B and Fluconazole (0.03 to 16µg/mL and ≤8 μg/ml- 16 to 32 μg/ml, respectively) as per the NCCLS recommendations, as the reference point to compare against five different concentrations of SDF. Candida parapsilosis ATCC 22019 was used as the control reference strain for this experiment, and its MIC fell within the expected normal range (0.25–2.0 and 0.5–4.0) at 24 hours, for Amphotericin B and Fluconazole, respectively [36].

The in vitro antifungal activity of varying volumes of SDF ranging from 0.625µl–15µl (equivalent to [Ag+] from 0.156mg –3.75mg, respectively) against four different Candida species, are shown in Table 2.

SDF demonstrated potent fungicidal activity against all tested Candida species, including all isolates of C. krusei and C. glabrata species (known to be resistant to conventional antifungals such as Fluconazole). The MIC₅₀of SDF in the volume range of 1.25µl –2.5µl (equivalent to 0.313 mg–0.625 mg of Ag+, respectively), demonstrated 50% growth inhibition of all C. albicans, C. krusei, C. glabrata isolates tested.

However, MIC₅₀ of SDF was higher (from 2.5µl to 5µl), with the Ag+ concentration range between (from 0.625 mg to 1.25 mg) for C. tropicalis. The lowest observed MIC of SDF at 1.25µl volume containing 0.313mg of Ag+ was seen against C. krusei and C. glabrata. The MIC₉₀ of SDF against all the tested Candida strains was almost two times higher than the MIC₅₀, with the range from 5µl–10µl volumes (containing 1.25mg –2.5 mg of Ag+, respectively).

The fungicidal effect of SDF was also determined by time-kill assay at different time-points, over a period of 48-hours (Figs. 3a-d). Only representative silver-ions concentrations (0.625–2.5mg) present in different SDF volumes previously determined by agar diffusion and standard broth microdilution methods were used for these experiments.

Clinical isolates of C. krusei and C. glabrata were treated with SDF volume of 5µl and 10µl (1.25mg and 2.5mg of Ag+) resulted in a complete cell-killing within 30-minutes. In contrast, C. tropicalis strains demonstrated relative resistance to killing, with total fungicidal activity achieved within 60 minutes of exposure to the identical SDF volumes containing 1.25mg- 2.5mg of Ag+. In general, all 35 tested clinical isolates belonging to four different common pathogenic Candida species were killed at the lowest volumes of SDF used, containing 2.5mg Ag+, after 2 hrs.

Ultrastructural observations

The antifungal effect of SDF on the cellular, ultrastructural topography of C. albicans was examined by scanning electron microscopy. We compared the untreated (control) C. albicans and counterparts exposed to SDF (5µl volume, 1.25mg Ag+ concentration) for 10 minutes and 1 hour (Figs 4 a-g).

The blastopores of C. albicans unexposed to SDF generally demonstrated intact, smooth cell walls with Grecian vase morphology and well-defined profiles (Fig 4a) while structural alterations to the blastopores exposed to SDF were evident after 10 min and the blastopores were virtually amorphous with significant deformation after 60 min exposure to SDF.

Energy Dispersive X-Ray Spectroscopy (EDS) analysis indicated concentrated silver ion deposition on the yeast blastopores after 10 min which became more intense after 60 min (Fig 4d and 4e), implying either Ag+ ion absorption/ adsorption on the yeast blastopores, that may have contributed to cell deformation and death.

The onset and progression of ECC are rapid and aggressive, leading to the widespread destruction of the enamel as well as the dentinal surfaces of the teeth [3]. Several microbiological studies, including those of ours (unpublished data), have shown that plaque biofilm, particularly from children with ECC, are co-infected with high levels of mutans-streptococci, and the common opportunistic oral fungal pathogen Candida. It is generally thought that co-habitation of yeasts and bacteria in such an inter-kingdom partnership results in the development of hypervirulent plaque biofilms that accelerates the destruction of the primary dentinal tissues. Hence, any ECC arresting medication must be both anti-bacterial as well as anti-fungal in nature. SDF appears to fulfill this criterion, as our data indicate that apart from its well-known antibacterial action, it is also anti-fungal/candidal in nature. To our current knowledge, this is the first study reporting the antifungal potential of SDF against human pathogenic yeasts. Current data demystifies to some extent the pharmacodynamics of SDF, as this antifungal is likely to disrupt cross-kingdom polymicrobial biofilm effectively, by its combinatorial approach.

The extreme effectiveness of SDF against several human pathogenic species of clinical Candida isolates from children with S-ECC can be explained by its ionic silver (Ag+) component. The primary constituents of SDF are ionic silver (Ag+, 25%w/v), fluoride (5%) a re-mineralizing agent and an antibacterial agent, and ammonia (8%), a stabilizing agent [37]. The bioactive form of silver in SDF in its ionized form, as “Ag+ ions.” can combine with halides (Cl^-, F^-, I^-), leading to the formation of anionic silver complexes, which are soluble in aqueous media and are highly bio-active. These silver complexes are known to be highly toxic to bacteria [14], as Ag+ targets bacteria through a three-pronged approach, by damaging cell-wall structure, denaturing cytoplasmic enzymes, and finally, inhibiting DNA replication [24]. Other workers have noted that the antibacterial effect of SDF is partly due to the interaction of silver-ions with the cell-membranes of cariogenic bacteria, and inactivation of their enzymes, leading to growth inhibition [39, 40]. The ultrastructural features of the SDF-exposed blastopores reported here tend to concur with these observations. Finally, silver ions in SDF is thought to impede dentine-collagen degradation by constraining cathepsins, and thereby arresting caries progression [41, 42].

We also evaluated the relative anti-candidal efficacy of SDF, fluconazole and amphotericin B. Conventionally, the latter two agents are effectively used in the management of oral candidiasis, caused by C. albicans and a spectrum of other Candida species [43]. Our results suggest that SDF also has an effective spectrum of antifungal activity, even superior to conventional drugs in combating non-albicans Candida species such as Candida krusei and Candida glabrata. Though, our current understanding of the mechanism of action of ionic Ag+ on fungal cells is limited. The ultrastructural and EDS observations reported here imply that Ag+ avidly binds to the yeast cell walls on exposure to SDF.

In the present study, we characterized the antifungal activity of silver-ions in SDF by an array of methods against four different Candida species, i) the agar diffusion assay, ii) microdilution assay, iii) the time-kill assay, and finally, iv) ultrastructural analysis by SEM. The disc diffusion method demonstrated clear susceptible zone diameters for all Candida species present in clinical isolates, including known fluconazole resistant strains of C. krusei and C. glabrata. These susceptibility results of Ag+-ions in SDF, intriguingly shows its multi-pronged antifungal potential against a variety of Candida strains present in deep niches of the dentine-caries lesions.

Our MICevaluations indicated the high MIC₅₀ and MIC₉₀ values for C. tropicalis relative to the other three tested species. This could be either due to the growth characteristics (e.g., rapid growth rate) or the target enzymes involved [38, 39]. However, further studies with several C. tropicalis strains are required to confirm the observed interspecies variations in SDF sensitivity.

The time-kill curves further confirmed the antifungal potency of SDF. Pharmacokinetics of time-kill observations suggest that the rate of fungicidal activity may be influenced by increased silver-ion concentrations in the suspension. However, the time necessary to achieve a 99.9% reduction in the numbers of CFU/ml observed was higher for C. tropicalis compared to other tested species, confirming the MIC observations described above. These data indicate that silver-ions in SDF does display primarily fungicidal effect against a variety of Candida species, but possible variations in the target enzyme could account for the interspecies differences in sensitivity. Another possible explanation could be the avidity of the biological ligands of this yeast to SDF [9]. Hall and team (2015), reported that many of the enzymes involved in yeasts-cell wall biogenesis are species-specific and are attractive antifungal targets [40].

Finally, our ultrastructural data imply that a clinical formulation of Ag+ ions at a concentration of 1.25mg in 5µl-SDF volume, robustly binds to the yeast cell walls possibly inactivating and causing cell death. In clinical terms, it is known that the polymicrobial, inter-kingdom biofilms are covered by a protective layer of extracellular polysaccharides that confers them protection against antimicrobials and chemotherapeutic agents [41, 42]. Therefore, it is crucial to ascertain the activity of SDF within such an ecosystem as our data essentially appertains to the SDF activity against planktonic yeasts. Nevertheless, the above information on the anti-candidal effect of SDF manifestly testifies to the immense potential of SDF as a cheap and effective anti-cariogens

Present data derived from 35 caries-associated clinical yeast isolates, for the first time, illustrate the anti-candidal potency of silver diamine fluoride, in addition to its widely known antibacterial activity.

S-ECC: severe early childhood caries; SDF: silver diamine fluoride; MIC: Minimal inhibitory concentrations; AMB:,Amphotericin B; FCZ: Fluconazole; SEM: Scanning electron microscopy; PCR: reverse transcription polymerase chain reaction.

Acknowledgement:

Jasmin Shafarin Abdul Salam of Research Institute of Medical and Health Sciences, University of Sharjah, is kindly acknowledged for her support in preparation of samples for SEM analysis. For ultrastructural topography using SEM, was performed by Mohammed Shamir at the Advanced Material Research Lab- Research Institute of Sciences and Engineering, University of Sharjah.

Authors contribution

K. S.F designed the experiment, laboratory analysis, data analysis and manuscript writing. L. P. S. involved manuscript conception, designed the experiment, data analysis and manuscript writing. H. E. critically examined and revised the manuscript and gave approval of the final version to be published. S. M. critically examined the manuscript. H. C. G. involved designed the experiment and examined the manuscript and gave final approval of the version to be published. T.V and C.P revised and approved the final version of the manuscript.

Funding

This work was funded by University of Sharjah oral biofilm in health and disease group establishment fund.

Availability of data and materials

Data of the present study were analyzed and presented in this published article along with additional files. Additional dataset if required, can be provided by the corresponding author on reasonable request.

Ethics approval and consent to participate

The present study was conducted under a protocol approved by the Research Ethics Committee, University of Sharjah (REC–18–02–18–03).

Consent for publication

Not applicable

Competing interests

Contributing authors declared no competing interests

Author details

¹ Department of Preventive and Restorative Dentistry, University of Sharjah, UAE. ² The University of Hong Kong, Hong Kong Special Administrative Region, China. ³ Division of Molecular and Regenerative Prosthodontics, Tohoku University Graduate School of Dentistry, Sendai, Miyagi, Japan. ⁴ Research Institute of Medical and Health Sciences, University of Sharjah, UAE

1.Kassebaum NJ, Bernabe E, Dahiya M, Bhandari B, Murray CJ, Marcenes W: Global burden of untreated caries: a systematic review and metaregression. J Dent Res 2015, 94(5):650–658.

2.Hajishengallis E, Parsaei Y, Klein MI, Koo H: Advances in the microbial etiology and pathogenesis of early childhood caries. Mol Oral Microbiol 2017, 32(1):24–34.

3.Anil S, Anand PS: Early Childhood Caries: Prevalence, Risk Factors, and Prevention. Front Pediatr 2017, 5:157–157.

4.Caufield PW, Li Y, Bromage TG: Hypoplasia-associated severe early childhood caries—a proposed definition. Journal of dental research 2012, 91(6):544–550.

5.Vargas CM, Ronzio CR: Disparities in early childhood caries. BMC Oral Health 2006, 6 Suppl 1:S3.

6.de Carvalho FG, Silva DS, Hebling J, Spolidorio LC, Spolidorio DMP: Presence of mutans streptococci and Candida spp. in dental plaque/dentine of carious teeth and early childhood caries. Archives of Oral Biology 2006, 51(11):1024–1028.

7.Yang XQ, Zhang Q, Lu LY, Yang R, Liu Y, Zou J: Genotypic distribution of Candida albicans in dental biofilm of Chinese children associated with severe early childhood caries. Archives of Oral Biology 2012, 57(8):1048–1053.

8.Raja M, Hannan A, Ali K: Association of oral candidal carriage with dental caries in children. Caries Res 2010, 44(3):272–276.

9.Xiao J, Huang X, Alkhers N, Alzamil H, Alzoubi S, Wu TT, Castillo DA, Campbell F, Davis J, Herzog K et al: Candida albicans and Early Childhood Caries: A Systematic Review and Meta-Analysis. Caries research 2018, 52(1–2):102–112.

10.Ghasempour M, Sefidgar SAA, Eyzadian H, Gharakhani S: Prevalence of candida albicans in dental plaque and caries lesion of early childhood caries (ECC) according to sampling site. Caspian journal of internal medicine 2011, 2(4):304–308.

11.Bowen WH, Burne RA, Wu H, Koo H: Oral Biofilms: Pathogens, Matrix, and Polymicrobial Interactions in Microenvironments. Trends Microbiol 2018, 26(3):229–242.

12.Pereira D, Seneviratne CJ, Koga-Ito CY, Samaranayake LP: Is the oral fungal pathogen Candida albicans a cariogen? Oral diseases 2018, 24(4):518–526.

13.Klasen HJ: A historical review of the use of silver in the treatment of burns. II. Renewed interest for silver. Burns 2000, 26(2):131–138.

14.Melaiye A, Youngs WJ: Silver and its application as an antimicrobial agent. Expert Opinion on Therapeutic Patents 2005, 15(2):125–130.

15.Morris GV, Kozdryk J, Gregory J, Jeys L: The use of silver-coated orthopaedic implants: are all silvers the same? Current Orthopaedic Practice 2017, 28(6):532–536.

16.Shawcross J, Bakhai A, Ansaripour A, Armstrong J, Lewis D, Agg P, De Godoy R, Blunn G: In vivo biocompatibility and pacing function study of silver ion-based antimicrobial surface technology applied to cardiac pacemakers. Open Heart 2017, 4(1):e000357.

17.Ammons MC, Ward LS, James GA: Anti-biofilm efficacy of a lactoferrin/xylitol wound hydrogel used in combination with silver wound dressings. International wound journal 2011, 8(3):268–273.

18.Youravong N, Carlen A, Teanpaisan R, Dahlén G: Metal-ion susceptibility of oral bacterial species. Letters in Applied Microbiology 2011, 53(3):324–328.

19.Yamamoto K, Ohashi S, Aono M, Kokubo T, Yamada I, Yamauchi J: Antibacterial activity of silver ions implanted in SiO2 filler on oral streptococci. Dental Materials 1996, 12(4):227–229.

20.Corrêa JM, Mori M, Sanches HL, da Cruz AD, Poiate E, Jr., Poiate IAVP: Silver nanoparticles in dental biomaterials. International journal of biomaterials 2015, 2015:485275–485275.

21.Clement JL, Jarrett PS: Antibacterial silver. Met Based Drugs 1994, 1(5–6):467–482.

22.Zhao IS, Gao SS, Hiraishi N, Burrow MF, Duangthip D, Mei ML, Lo EC-M, Chu C-H: Mechanisms of silver diamine fluoride on arresting caries: a literature review. International Dental Journal 2018, 68(2):67–76.

23.Chu CH, Mei LEI, Seneviratne CJ, Lo ECM: Effects of silver diamine fluoride on dentine carious lesions induced by Streptococcus mutans and Actinomyces naeslundii biofilms. International Journal of Paediatric Dentistry 2012, 22(1):2–10.

24.Peng JJY, Botelho MG, Matinlinna JP: Silver compounds used in dentistry for caries management: A review. Journal of Dentistry 2012, 40(7):531–541.

25.de Almeida LFD, Cavalcanti YW, Valenca AMG: In Vitro Antibacterial Activity Of Silver Diamine Fluoride In Different Concentrations

Acta Odontol Latinoam 2011, 24(2):127–131.

26.Targino AG, Flores MA, dos Santos Junior VE, de Godoy Bene Bezerra F, de Luna Freire H, Galembeck A, Rosenblatt A: An innovative approach to treating dental decay in children. A new anti-caries agent. Journal of materials science Materials in medicine 2014, 25(8):2041–2047.

27.Lou Y, Darvell BW, Botelho MG: Antibacterial Effect of Silver Diammine Fluoride on Cariogenic Organisms. The journal of contemporary dental practice 2018, 19(5):591–598.

28.Mei ML, Li Q-l, Chu C-H, Lo EC-M, Samaranayake LP: Antibacterial effects of silver diamine fluoride on multi-species cariogenic biofilm on caries. Annals of clinical microbiology and antimicrobials 2013, 12:4–4.

29.Carvalho A, Costa-De-Oliveira S, Martins ML, Pina-Vaz C, Rodrigues AG, Ludovico P, Rodrigues F: Multiplex PCR identification of eight clinically relevant Candida species. Medical Mycology 2007, 45(7):619–627.

30.Arendrup MC, Park S, Brown S, Pfaller M, Perlin DS: Evaluation of CLSI M44-A2 disk diffusion and associated breakpoint testing of caspofungin and micafungin using a well-characterized panel of wild-type and fks hot spot mutant Candida isolates. Antimicrobial agents and chemotherapy 2011, 55(5):1891–1895.

31.Pfaller MA, Espinel-Ingroff A, Boyken L, Hollis RJ, Kroeger J, Messer SA, Tendolkar S, Diekema DJ: Comparison of the broth microdilution (BMD) method of the European Committee on Antimicrobial Susceptibility Testing with the 24-hour CLSI BMD method for testing susceptibility of Candida species to fluconazole, posaconazole, and voriconazole by use of epidemiological cutoff values. Journal of clinical microbiology 2011, 49(3):845–850.

32.Pfaller MA, Bale M, Buschelman B, Lancaster M, Espinel-Ingroff A, Rex JH, Rinaldi MG, Cooper CR, McGinnis MR: Quality control guidelines for National Committee for Clinical Laboratory Standards recommended broth macrodilution testing of amphotericin B, fluconazole, and flucytosine. J Clin Microbiol 1995, 33(5):1104–1107.

33.Klepser ME, Ernst EJ, Lewis RE, Ernst ME, Pfaller MA: Influence of test conditions on antifungal time-kill curve results: proposal for standardized methods. Antimicrobial agents and chemotherapy 1998, 42(5):1207–1212.

34.Pfaller MA, Sheehan DJ, Rex JH: Determination of fungicidal activities against yeasts and molds: lessons learned from bactericidal testing and the need for standardization. Clinical microbiology reviews 2004, 17(2):268–280.

35.Samaranayake LP, MacFarlane TW: An in-vitro study of the adherence of Candida albicans to acrylic surfaces. Arch Oral Biol 1980, 25(8–9):603–609.

36.Barry AL, Pfaller MA, Brown SD, Espinel-Ingroff A, Ghannoum MA, Knapp C, Rennie RP, Rex JH, Rinaldi MG: Quality Control Limits for Broth Microdilution Susceptibility Tests of Ten Antifungal Agents. Journal of Clinical Microbiology 2000, 38(9):3457.

37.Horst JA: Silver Fluoride as a Treatment for Dental Caries. Advances in Dental Research 2018, 29(1):135–140.

38.Zuza-Alves DL, Silva-Rocha WP, Chaves GM: An Update on Candida tropicalis Based on Basic and Clinical Approaches. Frontiers in microbiology 2017, 8:1927–1927.

39.Forastiero A, Mesa-Arango AC, Alastruey-Izquierdo A, Alcazar-Fuoli L, Bernal-Martinez L, Pelaez T, Lopez JF, Grimalt JO, Gomez-Lopez A, Cuesta I et al: <span class = "named-content genus-species" id = "named-content–1">Candida tropicalis</span> Antifungal Cross-Resistance Is Related to Different Azole Target (Erg11p) Modifications. Antimicrobial Agents and Chemotherapy 2013, 57(10):4769.

40.Hall RA: Dressed to impress: impact of environmental adaptation on the Candida albicans cell wall. Molecular microbiology 2015, 97(1):7–17.

41.Berger D, Rakhamimova A, Pollack A, Loewy Z: Oral Biofilms: Development, Control, and Analysis. High Throughput 2018, 7(3).

42.Ramage G, Rajendran R, Sherry L, Williams C: Fungal biofilm resistance. International journal of microbiology 2012, 2012:528521.

Table 1. Amplicon sizes (base pairs) obtained from multiplex PCR amplification using yeast specific (Universal-UNI1 and UNI2) and corresponding species-specific primers for four different Candida spp.

Species	Primer	Sequence (5’-3’)	Amplicon size (bp)
	UNI 1 UNI 2	GTCAAACTTGGTCATTTA TTCTTTTCCTCCGCTTATTG
C. albicans	Calb	AGCTGCCGCCAGAGGTCTAA	583/446
C. tropicalis	Ctro	GATTTGCTTAATTGCCCCAC	583/507
C. krusei	Ckru	CTGGCCGAGCGAACTAGACT	590/169
C. glabrata	Cgla	TTGTCTGAGCTCGGAGAGAG	929/839

Table 2. MIC₅₀ and MIC₉₀of Amphotericin B, Fluconazole and SDF against four different Candida species (as determined by broth microdilution assay)

Candida species (number of isolates)

Silver Diamine Fluoride volumes (µl)

(containing mg of silver ions)

SDF µl

(mg of silver ions)

Fluconazole (µg)

Amphotericin B (µg)

0.625 µl

(0.156)

1.25 µl

(0.313)

2.5 µl

(0.625)

5 µl

(1.25)

10 µl

(2.5)

15 µl

(3.75)

MIC50 MIC90

C.albicans (10)

Number of isolates (percent growth)

10 (100%)

(90%)

(70%)

(10%)

(0%)

2.5 (0.625)

5.0 (1.25)

0.25

1.0

0.5

1.0

C.krusei (10)

10 (100%)

(70%)

(20%)

(0%)

1.25 (0.313)

2.5 (0.625)

≥32

0.25

0.5

C.glabrata (5)

5 (100%)

(80%)

(20%)

(0%)

1.25 (0.313)

2.5 (0.625)

8.0

0.25

0.5

C.tropicalis (10)

10 (100%)

(100%)

(40%)

(10%)

(0%)

5 (1.25)

10 (2.5)

1.0

2.0

1.0

2.0

Download PDF

Journal Publication

published 15 Apr, 2020

Read the published version in BMC Microbiology →

Review #2 received at journal
06 Dec, 2019
Editorial decision: Major revision
06 Dec, 2019
Review #1 received at journal
03 Dec, 2019
Reviewer #2 agreed at journal
24 Nov, 2019
Reviewers invited by journal
23 Nov, 2019
Reviewer #1 agreed at journal
23 Nov, 2019
Editor assigned by journal
05 Nov, 2019
Submission checks completed at journal
04 Nov, 2019
Editor invited by journal
04 Nov, 2019

You are reading this older preprint version

Read the latest preprint version →

Silver diamine fluoride (SDF) used in childhood caries management has potent antifungal activity against oral Candida species

Status:

Journal Publication

Version 1

Abstract

Figures

Background

methods

Multiplex PCR:

Antifungal susceptibility assay by disc diffusion:

Broth microdilution antifungal susceptibility assay:

Time-kill assay:

Scanning electron microscopy:

Statistical Analysis:

Results

The effect of SDF on different Candida species

Evaluation of minimum inhibitory concentrations (MIC)

discussion

conclusion

abbreviations

DECLARATIONS

Acknowledgement:

Authors contribution

Funding

Availability of data and materials

Ethics approval and consent to participate

Consent for publication

Competing interests

Author details

REFERENCES

TABLES

Status:

Journal Publication

Version 1