Patients
Case-1, a 2-year-old girl with 46, XY DSD came to our hospital. Physical examinations of female external genitalia were done. B-ultrasound was done to detect male or female internal genital organs, including testis, uterus, and ovaries. Hormone assay and karyotype analysis were performed. 219 DSD–related genes were sequenced.
Case-2, Case-1’s younger sibling, who is at 25 weeks’ gestation, is suspected with 46, XY DSD. Type-B ultrasonic test, chromosome karyotype analysis and SRD5A2 gene sequencing were done for 46, XY DSD. When she is aborted, physical examinations were performed for female external genitalia and HE staining for testis tissue and epididymis tissue.
An informed written consent for the genetic studies were obtained from the family, and all researches were approved by the Medical Ethical Committee of the People’s Hospital of Xingtai City.
Hormone assays
Serum levels of FSH, LH, estradiol (E2), progestin (PROG), T, and prolactin (PRL) for the proband were measured by radioimmunoassay.
Karyotype analysis
Peripheral blood cells from the proband were cultured in RPMI1640 medium supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, and 10% fetal bovine serum (FBS) for 72 hours. Colchicine (20 mg/ml) was added for two hours to arrest cells in metaphase and inhibit spindle body formation. Samples were incubated for 20 minutes with 75 mM potassium chloride to spread out the spindle body and fixed in Carnoy’s solution. Fixed cells were dropped onto glass slides and placed in an incubator at 75 °C for three hours to air-dry. Giemsa solution was used to stain the G-bands of the chromosomes.
FISH analysis
The uncultured amniotic fluid cells from the unbirthed sibling of the proband were obtained for the FISH test. The probes were used to test chromosome 13, 21, 16, 22, 18, X and Y.
Genetic analysis
The peripheral blood samples of the case-1, her unbirthed sibling, her birthed sibling, her father, her mother, her maternal uncle, her grandfather, her grandmother were obtained for DNA sequencing. The genomic DNA was extracted according to the manufacturer's instructions using the TIANamp Blood DNA Kit (TIANGEN, China). The sequencing of the proband’s 219 DSD–related genes was performed by BGI using the Illumina Genome Analyzer IIx for (supplementary Table 1). The mutation genes in the case-1, her unbirthed sibling, her birthed sibling, her father, her mother, her maternal uncle, her grandfather, her grandmother were sequenced by sanger sequencing. The gene mutations were identified by comparing the sequencing results of the case to the UCSC reference genome using the BWA tool.
Construction of human SRD5A2 site-directed mutagenesis
Human SRD5A2 cDNA was kindly provided from professor Jiahuai Han (Xiamen University) and was subcloned into vector pcDNA3.1 (with 3Flag tag, purchased from Life Technologies). To generate 695A>G mutation in SRD5A2 gene, the pcDNA3.1-SRD5A2 plasmid was used as template and the QuikChange II Site-Directed Mutagenesis Kit (Catalog #200523, Agilent) was used to produce the mutataion site according to manufacturer’s instruction. The primers for cloning the 695A>G mutation in SRD5A2 gene as following:
SRD5A2 mF-695: gcgagcttttcaccaccGtaggttctacctcaagatgtttg
SRD5A2 mR-695: catcttgaggtagaacctaCggtggtgaaaagctcgcag
Transfection assay
HEK293 cells (purchased from the Chinese Academy of Sciences Cell Bank in Shanghai) were cultured in Dulbecco's Modified Eagle's Medium supplemented with 10 % fetal bovine serum (Gibco, USA) and 1 % streptomycin/penicillin (Gibco, USA). The cells were transiently transfected with 2.0 μg wild-type or p.H232R mutant SRD5A2 plasmids in each well of 6 well plate using the TurboFect™ Transfection Reagent (Thermo Scientific) accoding to the manufacturer's protocol. The transfected HEK293 cells were cultured in 5% CO2 at 37 °C for 48 h before the assays.
DNA sequencing of transfection plasmids
HEK293 cells were transfected with wild-type or p.H232R mutant SRD5A2 plasmids for 48 hours and Sanger sequencing were used to assess the DNA sequence. Briefly, the DNA samples were isolated by TIANamp Genomic DNA kit (Cat# DP304-02,TIANGEN, China). The concentration and purity of the DNA were determined by NanoDrop (at 260/280 nm, ND2000C, Thermo). The DNA samples were amplified by polymerase chain reaction (PCR) and sequenced by Genewiz corporation (Suzhou, China).
Primer sequences for PCR are listed below.
SRD5A2-Fseq: AGCCCGTTAAGCAGTTGAGG
SRD5A2-Rseq: CGGCTTCTTCCGCTTCTTGA
Quantitative real-time PCR
Quantitative real-time PCR (qRT-PCR) were performed to assess the mRNA expression after wild-type or p.H232R mutant SRD5A2 plasmids transfection for 48 hours. The total RNA was isolated by RNAiso Plus (Cat# 9109, TaKaRa) and reverse transcription was done using the PrimeScript™ RT reagent kit (RR047A, Takara) according to the manufacturer's protocol. qPCR were performed using PrimeScript™ RT reagent Kit (RR037A, Takara) by ViiA7 Real-time PCR System ( ABI). The PCR cycle included: 95℃ for 30s, followed by 40 cycles of 95℃ for 5 s and 60℃ for 34s. The relative quantification for SRD5A2 mRNA was assessed by 2-ΔΔCt method.
Primer sequences for qPCR are listed below.
SRD5A2F: GCCACTTTGGTCGCCCTT
SRD5A2R: CTCCGTGTGCTTCCCGTAG
β-actinF: AGAGCTACGAGCTGCCTGAC
β-actinR: AGCACTGTGTTGGCGTACAG
Western Blot
Western Blot were performed as previously describled Briefly(32), after HEK293 cells transfected with wild-type or p.H232R mutant SRD5A2 plasmids 48 hours, the cells were collected from 6-well plates and lysed by RIPA buffer (P0013, Beyotime Biotechnology). The whole-protein lysates were separated by 12% SDS-PAGE and then transferred to nitrocellulose membranes. After blocked by 5% milk, the membranes were incubated with primary antibodies monoclonal anti-flag (F9291, sigma) and β-Actin (sc-69879, santa) at 4℃ overnight. After rinsed by Tris-buffered saline containing 1% Tween-20 (TBST), the membrane was then incubated with appropriate HRP-conjugated secondary antibodies (sc516102, Santa Cruz) and detected by an ECL Plus kit (P1050, Applygen).
Kinetic assays
Kinetic assays were performed to assess the steroid 5α-reductase 2 activity after transfected p.H232R mutant SRD5A2 plasmid into HEK293 cells. The cells were collected from 6-well plates and resuspended in 200 μl of Tris-Citrate buffer (pH 5.5). The resuspended cells were sonicated 2 min (HD3100, BANDELIN) and subsequently incubated at 37°C for 15 min with 500 μM of NADPH (CAS: 100929-71-3, N302057, aladdin) and various concentrations of T (0.25–8.0 μmol/L, CAS: 58-18-4, M163044, aladdin). The steroids were extracted with chloroform, condensed by a freeze-drying apparatus and re-dissolved in chromatographic methanol for Liquid Chromatography–Mass Spectrometry (LC–MS) analysis, using buffer A containing 1 mM Formate (F112034, aladdin) and buffer B containing 100% methanol. DHT were quantified according the concentration and peak area of the standard DHT (CDCT-C10255010, ANPEL Laboratory Technologies (Shanghai) lnc.). The protein concentration was determined using BCA assays (P0012S, Beyotime). The rate of enzyme production (nmol/mg prot/h) were calculated as indicators of enzyme activity. The data were processed by Prism8 (GraphPad). The experiments on each groups were repeated three times. The data were represented as mean ± SEM.
Sequence alignment of SRD5A2 in humans and other species
FASTA format SRD5A2 sequences of the homologous species were downloaded from the NCBI database. Protein sequences of SRD5A2 between human and the other homologous species were aligned by MEGA software.
Pathogenicity analysis for human SRD5A2 p.H232R mutation
The pathogenicity of human SRD5A2 p.H232R mutation were analyzed using the following bioinformatics programs:
Polyphen-2: http://genetics.bwh.harvard.edu/pph2/
SIFT: http://sift.jcvi.org
PROVEAN: http://provean.jcvi.org/seq_submit.php