Effect of marketable ages on meat quality through fiber characteristics in goose

doi:10.21203/rs.3.rs-79406/v1

Download PDF

Research

Effect of marketable ages on meat quality through fiber characteristics in goose

https://doi.org/10.21203/rs.3.rs-79406/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 01 Dec, 2020

Read the published version in Poultry Science →

Version 1

posted

You are reading this latest preprint version

Background: Goose meat is more and more popular among consumers because of its good quality. The fiber characteristics, as a key determinant factor, contributing to meat quality has been well demonstrated, and the marketable ages are also closely related to meat quality in livestock and chicken. However, little is known about the effect of different marketable ages on the meat quality through fiber characteristics in goose.

Results: Here, 1-day, 28-day and three market-age old (70, 90 & 120 days) Yangzhou geese were selected and their fiber characteristics were investigated. The results showed that only fast-twitch fibers were observed in the breast muscle irrespective of the ages, while little slow-twitch fibers could be identified in leg muscle in three marketable ages, especially in gastrocnemius and extensor digitorum longus. As for the fiber diameter, a rapid upward trend was observed in breast muscle from 70 days to 90 days, and the corresponding values were 19.88 to 26.27μm, respectively, and it remained stable 90d thereafter. While the diameter and cross-sectional area of muscle fiber in leg muscle increased with ages. In addition, the proximate composition and physical properties was measured at different ages. 120-day-old geese had richer intramuscular fat and protein content both in breast and leg meat, as well as lower moisture content among three marketable ages. The higher lightness and pressing loss and the lower redness and shear force was observed in the breast and leg meat of 70-day-old geese compared with the 90 and 120-day-old geese.

Conclusions: Taken together, although longer marketable age did not affect muscle fiber type in geese, it resulted in a thicker muscle fiber area, richer intramuscular fat and protein content, redder and chewier meat. As a result, the reasonable marketable age should be taken into account to improve the meat quality in the goose production.

Biotechnology and Bioengineering

Animal Science

Goose Muscle fibers Marketable ages Meat quality

Table 1. Ingredient and nutrient levels of the commercial diets in geese (29 -120 days).

Items	Content
Ingredients, %
Corn	56.0
Soybean meal	21.0
Wheat bran	15.0
Premix	5.0
Bone meal	3.0
Nutrient levels
Crude protein, %	17.2
Crude fat, %	3.7
Crude fiber, %	5.3
Ca, g/kg	10.7
Total P, g/kg	4.8
Lys, g/kg	7.6
Met, g/kg	4.4
Apparent ME, KJ/kg	10.5

Note: Premix provided per kilogram of diet: vitamin A, 2000 IU; vitamin D3, 45000U; vitamin E, 300IU; vitamin K3, 20 mg; vitamin B1, 10 mg; vitamin B2, 120 mg; vitamin B6, 20mg; nicotinic acid, 600 mg; pantothenic acid, 180 mg; folic acid, 10 mg; choline, 7 g; Fe, 1.2 g; Cu, 0.2 g; Mn, 1.9 g; Zn, 1.8 g; I, 10 mg; Se, 6 mg. ME: Metabolic Energy.

Table 2 Primers for RT-qPCR of MyHC-related genes

Genes	Accession number	Primer sequence (5'→3')	Annealing temperature (°C)
MYH7B	NM_204587.1	F GCTGCGGTGTAACGGTGTC	60
		R CTGGAATGGCTGCTGGGT
MYH1A	NM_001013396.1	F GGGAGACCTGAATGAAATGGAG	60
		R CTTCCTGTGACCTGAGAGCATC
MYH1B	NM_204228.3	F GAAGAAGAAGATGGAGGGAGACC	60
		R CTCCTGTGTCCTGAGAGCATCAT
β-actin	M26111.1	F GAGAAATTGTGCGTGACATCA	60
		R CCTGAACCTCTCATTGCCA

Note: All the primers are designed with Primer 5.0 software and synthesized by Nanjing Qingke bioengineering company. F forward primer. R reverse primer. MyHC, myosin heavy-chain. MYH7B (type I) slow-twitch myosin heavy-chain. MYH1A (type IIb) fast-twitch myosin heavy-chain. MYH1B (type IIa) fast-twitch myosin heavy-chain.

Table 4. Comparison on physical properties among goose meat of different marketable ages

Marketable ages	Muscular tissues	pH_{45 min}	pH_{24 h}	Meat color			Pressing loss (%)	Shear force (N)
Marketable ages	Muscular tissues	pH_{45 min}	pH_{24 h}	L*	a*	b*	Pressing loss (%)	Shear force (N)
70 days	Breast	6.02±0.19	5.61±0.04^c	47.58±2.37^a	14.93±1.60^b	7.72±2.29	20.58±2.53^b	24.48±1.52
70 days	Leg	5.81±0.09	5.63±0.03^c	42.83±2.15^b	17.00±0.22^ab	7.77±0.60	24.51±0.99^a	41.13±3.88
90 days	Breast	6.08±0.07	5.61±0.04^c	39.29±1.18^c	19.16±1.43^a	6.31±1.29	19.90±1.84^b	27.26±3.09
90 days	Leg	5.98±0.10	5.71±0.05^b	40.07±1.27^bc	16.96±0.73^ab	7.39±0.58	17.97±1.46^b	42.46±1.60
120 days	Breast	6.04±0.18	5.69±0.06^b	34.69±1.27^d	18.68±1.58^a	7.68±1.14	18.81±1.46^b	27.56±2.86
120 days	Leg	5.94±0.06	5.78±0.07^a	39.22±1.57^c	18.67±1.10^a	8.37±0.53	14.42±1.35^c	45.15±4.80
Marketable ages	70 days	5.94±0.19^b	5.62±0.04	45.21±3.30	15.96±1.53	7.74±1.50	22.55±2.75	31.62±9.24
	90 days	6.04±0.09^a	5.66±0.07	39.68±1.18	18.06±1.58	6.85±1.07	18.93±1.82	34.01±8.36
	120 days	5.99±0.14^ab	5.74±0.08	36.95±2.79	18.67±1.21	8.03±0.88	16.61±2.72	38.55±9.92
Muscular tissues	Breast	6.05±0.15^a	5.63±0.05	40.52±5.84	17.59±2.41	7.24±1.59	19.76±1.89	26.41±2.76^b
Muscular tissues	Leg	5.90±0.11^b	5.69±0.07	40.70±2.20	17.54±1.08	7.84±0.65	18.96±4.57	43.25±3.86^a
P-Value（Two-Way ANOVA）
Marketable ages		0.033	0.000	0.000	0.006	0.268	0.000	0.148
Muscular tissues		0.001	0.000	0.822	0.940	0.320	0.331	0.000
Marketable ages * Muscular tissues		0.268	0.009	0.002	0.032	0.771	0.003	0.759

Note:^a,b,c,d Means ± SE with different superscript are significantly different in the same line (P<0.05).

Table 4. Comparison on proximate composition among goose meat of different marketable ages

Marketable ages	Muscular tissues	Moisture content (%)	Protein content (%)	Intramuscular fat content (%)	Collagen content (%)
70 days	Breast	77.90±0.20^a	22.22±0.06^d	1.67±0.04^d	1.45±0.01^ab
70 days	Leg	76.02±0.08^b	23.51±0.02^b	1.65±0.02^d	1.26±0.04^c
90 days	Breast	73.93±0.14^c	23.55±0.03^b	2.77±0.05^b	1.35±0.02^bc
90 days	Leg	75.92±0.37^b	23.69±0.19^b	1.73±0.04^d	1.12±0.05^d
120 days	Breast	72.65±0.04^d	22.88±0.01^c	3.21±0.03^a	1.53±0.07^a
120 days	Leg	73.75±0.05^c	24.09±0.03^a	2.68±0.01^c	1.10±0.02^d
Marketable ages	70 days	76.96±0.43	22.86±0.29	1.66±0.02	1.36±0.05
	90 days	74.93±0.48	23.62±0.09	2.25±0.24	1.24±0.06
	120 days	73.20±0.25	23.48±0.27	2.94±0.12	1.31±0.10
Muscular tissues	Breast	74.83±0.79	22.88±0.19	2.55±0.23	1.44±0.03
Muscular tissues	Leg	75.23±0.39	23.76±0.10	2.02±0.17	1.16±0.03
P-Value（Two-Way ANOVA）
Marketable ages		0.000	0.000	0.000	0.000
Muscular tissues		0.001	0.000	0.000	0.000
Marketable ages * Muscular tissues		0.000	0.000	0.000	0.011

Note:^a,b,c,d Means ± SE with different superscript are significantly different in the same line (P<0.05).

TableS1.docx
TableS2.docx
Fig4S.tif
Intramuscular adipocytes between breast muscle fibers in the 28 day old goose. Magnification of 900 × was used (Bar=20 μm).

Download PDF

Journal Publication

published 01 Dec, 2020

Read the published version in Poultry Science →

Version 1

posted

You are reading this latest preprint version

Effect of marketable ages on meat quality through fiber characteristics in goose

Status:

Journal Publication

Version 1

Abstract

Figures

Full Text

Tables

Supplementary Files

Status:

Journal Publication

Version 1