2.1 Mice
All mice were bred and maintained at the Animal Facility of the Fudan University of Medicine. 6 weeks female BALB/c and 5 weeks nude mice were originally obtained from the Shanghai SLAC Co. (Shanghai, China). Mice were acclimated for 1 week to the housing condition before the experiments began, and then 2-3 mice per cage housed in a laminar air flow room with a relative humidity of 55.5%. Each room was maintained at 22°C with a light-dark cycle of 12h light and 12h dark throughout the experiment. Ethics statement Animal care and manipulation was in agreement with institutional guidelines, which are in accordance with the Guide for the Care and Use of Laboratory Animals. All animal experimental procedures used in this study were approved by the Fudan University of Animal Ethics Committee. All surgery was performed under sodium pentobarbital anesthesia, and all efforts were made to minimize suffering.
2.2 Induction of asthmatic mice model
6 weeks female BALB/c mice were developed by OVA sensitization and inhalation as described previously[21]. In brief, on days 0, 7, and 14, mice were sensitized with an intraperitoneal (i.p.) injection of 0.2 mL alum-precipitated antigen in phosphate-buffered saline (PBS) which contained 80 µg of OVA mixed with 2 mg aluminum hydroxide. After sensitization, the mice were exposed to aerosolized OVA for 30 min/day on days 20–24. The concentration of OVA was 1.5% to induce the asthmatic condition. The AS-IV treatment group mice were given 40, 20, or 10 mg/Kg, Astragaloside IV, respectively (Y0001171, C41H68O14, molecule weight: 784.97, Winherb Medical Science Co., Ltd Shanghai, CAS 84687-43-4) (dexm 1mg/kg or 0.9% Nacl) by intraperitoneal injection. The doses of AS-IV used in the study refer to the relevant literature and data[22, 23]. The animal study protocols were approved by the Institutional Animal Care and Use Committee of Fudan University.
2.3 The cell culture
2.3.1 Isolation of splenocytes
The BALB/c mice were euthanized with amobarbital sodium. Their spleens were collected at necropsy. Each spleen was aseptically homogenized using a glass tissue grinder. The cell suspension was centrifuged at 300 x g for 5 minutes at 4°C. The pellet was treated with erythrocyte lysis buffer (0.19 M NH4Cl) for 5 to 10 minutes at 4°C, centrifuged (as above), and washed twice with RPMI 1640 medium ( Invitrogen/Gibco BRL, Grand Island, NY, USA). Splenocytes were then suspended in complete RPMI 1640, that is, medium supplemented with 10% fetal calf serum (Invitrogen/Gibco BRL, Grand Island, NY, USA) and antibiotics (100 U/mL penicillin, 100 µg/mL streptomycin)( Dojindo Laboratories, Kamamashiki, Kumamoto, Japan). The viability using trypan blue (Invitrogen/Gibco BRL, Grand Island, NY, USA) exclusion was determined.
2.3.2 The splenocytes cells culture
The splenocytes cells were diluted in complete medium and dispensed into 96-well plates at 5 × 105 cells/well/100 µL. The high, medium, and low doses of AS-IV used in vivo were 5ug/ml, 10ug/ml, and 20ug/ml, respectively, while control wells received only the culture medium. Cells were cultured in 96-well plates (Corning Inc., New York, NY, USA.), and viability was assessed using a commercial kit (Cell Counting Kit-8, Dojindo Laboratories, Japan) in accordance with the manufacturer’s instructions. The details of the protocol have been described in our previous research. All samples were analyzed in triplicate.
2.4 Histological Scoring
Lungs were perfused with PBS to remove blood. In experiments with airway challenge, the left lung lobe was tied off for flow cytometry and the right lobe was fixed in 10% methanal and embedded in paraffin. Sections were stained with hematoxylin and eosin (H&E) as previously described[24].
2.5 Magnetic-activated cell sorting
Magnetic-activated cell sorting (MACS) were used to isolate splenocytes. Splenocytes were collected, cells were isolated using magnetic microbeads and magnetic-activated cell sorting columns according to the manufacturer's protocol(all reagents were from Miltenyi Biotec, Bergisch Gladbach, Germany). T cells were counted directly after MACS. T cell viability was determined by trypan blue exclusion. CD4(+) T cells and TCM purity levels were always found to be 98% and 96%, respectively.
2.6 Adoptive transfer of TCMs into nude mice
Six groups of nude mice(5 weeks) were transfused with CD62Lhigh CD4(+)T cells isolated from spleen cells of OVA-stimulated asthma group, normal group, dexameathone and AS-IV(3 different doses) treated BALB/c mice via tail intravenous injection respectively. According to the research[25], 1.0 × 106 TCMs in 150 µl PBS were injected into nude mice i.v. through the tail vein. One day after the cell transfer, all mice were given daily challenge with OVA for 3 days, as indicated in the figure legends. Seven days after the challenge, mice were euthanized, and their spleens and lungs were collected at necropsy. Splenocytes were detected by flow cytometry and the lung tissues were stained with hematoxylin and eosin (H&E).
2.7 Determination of spleen weight and spleen index
After adoptive transfer of TCMs and continuous OVA stimulation for 3 days, the nude mice were terminated at the 7th day. The spleen was immediately separated. The surrounding connective tissue and fat were excluded. The organs were dried of surface moisture using filter paper and weighed. Viscera indexes for the spleen were calculated by the following formula: organ index = organ weight (mg)/body weight (g).
2.8 Flow cytometry
To assess circulating CD4(+) T lymphocytes and their subsets as predictors of AS-IV treatment response at baseline, 23, 30, 40, 50, 63, or 70 days after OVA sensitization. Multicolor flow cytometry were used to quantify the expression of CD62L、CCR7、CD44 on CD4(+) T cells present in peripheral blood(blood was collected from the posterior eyeball vein using a glasscapillary tube). At 70 days, the mice were killed, spleen samples were collected. The cells were lysed with Pharm Lyse buffer (BD Biosciences, San Jose, CA, USA) according to the manufacturer’s instructions. Cell suspensions were washed and incubated in PBS supplemented with 1% bovine serum albumin (BSA; Sigma-Aldrich), 1% mouse serum (Life Technologies). Cells were then stained with antibodies in 1% BSA/1% mouse serum/ PBS for 45 min on ice. Antibodies used were: anti-CD4- PerCP-Cy5.5, anti-CCR7-PE, anti-CD62L-APC, anti-CD44-FITC(all from BD Biosciences, San Jose, CA, USA). Data were analyzed using FlowJo. MFI (mean fluorescence intensity) was determined by subtracting the MFI of the FMO (fluorescence minus one) control from the MFI of the stained sample.
2.9 Real-time PCR
Total RNA was extracted using TRIzol (Sigma Chemical Co. St. Louis, MO, USA) according to the manufacturer’s instructions. Quantification was performed with a two-step reaction process: reverse transcription (RT) and PCR. Each RT reaction consisted of 0.5 mg RNA, 2 mL of PrimerScript Buffer, 0.5 mL of oligo dT, 0.5 ml of random 6 mers, and 0.5 mL of PrimerScript RT EnzymeMix I (TaKaRa Bio, Japan), in a total volume of 10 mL. Reactions were performed in a PCR system 9700(Applied Biosystems,USA) for 15 min at 37°C, followed by heat inactivation at RT for 5 s at 85°C. The 10 mL RT reaction mix was then diluted × 10 in nuclease-free water and held at −20°C. Real-time PCR instrument with 10 mL PCR reaction mixture that included 1 mL of cDNA, 5 mL of 2 × SYBR Green I MAS-IVer (Roche, Swiss), 0.2 mL of forward primer, 0.2 mL of reverse primer and 3.6 mL of nucleasefree water. Reactions were incubated in a 384-well optical plate (Roche, Swiss) at 95°C for 10min, followed by 40 cycles of 95°C for 10 s, 60°C for 30 s. Each sample was run in triplicate for analysis. At the end of the PCR cycle, melting curve analysis was performed to validate the specific generation of the expected PCR product. The primer sequences were designed in the laboratory and synthesized by Generay Biotech(Shanghai, China), based on the mRNA sequences obtained from the NCBI database. Primers used for PCR amplification are listed in Table 1. The expression levels of mRNAs were normalized to GAPDH and were calculated using the 2 − ΔΔCt method.
Table 1
Primers used for PCR amplification
Gene | Forward primer | Reverse primer |
OX40 | TTCTTGCCTGTCCGCCTACT | GCTGCTGAACCCACACATACAT |
OX40L | TGCTTCTGTGCTTCATCTATGT | TGGTAACTGCTCCTCTGAGTCT |
IFN-r | CATAGATGTGGAAGAAAAGAG | AGAGTCTGAGGTAGAAAGAGATA |
IL-4 | TAGTTGTCATCCTGCTCTTCTT | CTCACTCTCTCTGGTGTTCTTC |
IL-17A | GGCTGACCCCTAAGAAAC | ATTCCTTGCTGAAAATCAATAG |
IL-13 | CAGCCTCCCCGATACCAAAAT | CCCCAGCAAAGTCTGATGTGA |
GADPH | CTTTGGCATTGTGGAAGGGC | CAGGGATGATGTTCTGGGCA |
2.10 Western blot analysis
Spleen tissues or splenocytes were homogenized in buffer with a protease inhibitors and incubated for 30min at 4°C. Tissue or cell debris were removed by centrifugation (12 000 × g, 15 min), then boiled 5 min at 98°C with SDS-PAGE loading buffer, and stored at −80°C until used. The protein concentration was determined by BSA method. 30mg of protein were electroblotted onto a PVDF membrane, following separation on a 10% SDS-polyacrylamide gel electrophoresis. The immunoblot was incubated 1h with 5% milk at room temperature, and then incubated overnight at 4°C with 1:1000 dilution of anti-OX40 antibody(Santa Cruz Biotech, CA, sc-21000) and 1:1000 dilution of β-actin antibody(Santa Cruz Biotechnology, sc-130656), respectively. Blots were washed three times with Tween-20/Tris-buffered saline (TTBS) and then incubated with a 1:10000 dilution of HRP-conjugated secondary antibody for 1h at room temperature. The optical density (OD) of the target proteins was shown as a proportion of b-actin OD.
2.11 Statistical analysis
Statistical analysis was conducted using the Statistical Package for Social Sciences (SPSS v.11, Chicago, IL, USA). The significance of the differences was determined by one-way ANOVA, comparisons of parameters between 2 groups were performed with LSD or Games-Howell test. Qualitative data between groups were compared by Pearson’s χ2 test or Fisher exact test, as appropriate. The data analysis of qPCr gene expression levels of the control group were set at 1-fold, and gene expression changes of other groups were expressed as the normalized “fold” change in mRNA expression compared with the control group. The significance thresholds were 0.05 in all analysis.