This is a preprint. Preprints are preliminary reports that have not undergone peer review. They should not be considered conclusive, used to inform clinical practice, or referenced by the media as validated information.
Primary research
tRNA Ini CAT inhibits proliferation and promotes apoptosis of laryngeal squamous cell carcinoma cell
Zhisen Shen
Ningbo Medical Treatment Centre Li Huili Hospital
Corresponding Author
ORCiD: https://orcid.org/0000-0001-6660-0488
License:
This work is licensed under a CC BY 4.0 License. Read Full License
Background: Transfer RNA (tRNA) is a ubiquitous RNA, present in all life forms and considered a housekeeping gene with limited regulatory function. Recent studies have shown that tRNA is dysregulated and involved in the pathogenic process of cancer.
Methods: Quantitative reverse transcription-polymerase chain reaction detected the relative expression levels of tRNAIniCAT in paired LSCC tissues and paracancerous tissues and preoperative, postoperative, and healthy human plasma. We analyzed the relationship between its expression level and the clinicopathological features of patients. We also established the receiver operating characteristic curve and predicted its diagnostic value. High expression of tRNAIniCAT was detected in the LSCC cell line. The proliferation, apoptosis, and cycle of cells were analyzed. High expression of tRNAIniCAT was detected in mice with transplanted tumors. The tumor weight and volume in mice were measured. The transplanted tumor was used for pathological analysis and transmission electron microscope observation.
Results: tRNAIniCAT was down-regulated in LSCC tissues and plasma. The area under the plasma receiver operating characteristic curve was 0.808. High expression of tRNAIniCAT in the laryngeal carcinoma cell line inhibited cell proliferation and promoted apoptosis. High expression of tRNAIniCAT in transplanted tumor in nude mice inhibited the growth of the transplanted tumor.
Conclusion: tRNAIniCAT acts as a tumor Inhibitor in LSCC, inhibits cell proliferation, and promotes apoptosis in vitro and in vivo. tRNAIniCAT may be used as a new biomarker for the early diagnosis of LSCC.
Keywords
tRNA, tRNAIniCAT, biomarkers, laryngeal squamous cell carcinoma, diagnosis
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16
Figure 17
Figure 18
Figure 19
Laryngeal cancer is a common malignant tumor of the head and neck. It is common among men aged 50–70 years. Its incidence is 1.5–3/100,000, accounting for approximately 1% of all malignant tumors. Laryngeal squamous cell carcinoma (LSCC) is the most common type, accounting for approximately 90% of cases.1 At present, the incidence of laryngeal cancer is increasing. Treatment is mainly through surgical resection, combined with preoperative or postoperative chemotherapy, radiotherapy, and other comprehensive therapies. However, vocal disorders occur following surgery, affecting the quality of life of patients. Globally, more than 80,000 patients with throat cancer expire each year.2
Transfer RNA (tRNA) is a universal RNA present in all forms of life. A mature tRNA is characterized by its secondary structure, which consists of a D ring, a counterpasser ring, a variable ring, a T ring, and an receiving arm, as well as an L tertiary structure maintained by hydrogen bonds.3 As a basic component of the translation process, tRNA transport amino acids to the ribosome; the genetic information of the nucleotide sequence is transformed into the corresponding polypeptide chain in the manner of codon (mRNA)-anti-crypton (tRNA) interaction; 4, 5 this process is essential to maintain the normal life activities of the body. More than half of RNA modifications occur in tRNA.6 These modifications affect the structure, stability, and functionality of tRNA, leading to widespread cellular effects; of those, methylation modification is the most common effect .7
Early studies reported that tRNA plays only the role of a "porter", and does not possess regulatory function. Nevertheless, as research progresses, tRNA have been found to be involved in various physiological and pathological processes, including cancer, diabetes, and neuronal disease .8–11 The role of tRNA in LSCC remains unknown and there is no complete tRNA expression map on this disease. This study established tRNA expression profiles from eight pairs of LSCC and paracancerous tissues via a microarray platform. In addition, the relative expression levels of tRNAIniCAT in tumor and paracancerous tissues, preoperative and postoperative plasma of patients with LSCC and plasma of healthy human were examined. The tRNAIniCAT was analyzed to determine the relationship between its expression level and clinicopathological features. The work characteristic curves of the subjects were established to predict their diagnostic value. The tRNAIniCAT was upregulated in laryngeal cancer cell lines. The proliferation, apoptosis, and cycle of cells were analyzed. High expression of tRNAIniCAT was observed in mice transplanted with tumors. The tumor weight and volume in mice were measured, and the tumors were analyzed by pathology and transmission electron microscopy (TEM). Finally, the usefulness of tRNAIniCAT as biomarker and potential therapeutic target for LSCC was examined.
Collection of specimens and clinical data
Patients with LSCC who underwent otorhinolaryngology and head and neck surgery at Li Huili Hospital affiliated to Ningbo University (Ningbo, China) from January 2013 to April 2019 without receiving radiotherapy, chemotherapy, or other antitumor treatments were selected. Tumor tissue and paracancerous tissue samples were obtained from surgery. All LSCC samples were confirmed by at least two senior pathology experts. Healthy human plasma samples were used to obtain plasma samples before and after surgery. Tumor staging was determined according to the American Joint Committee on Cancer tumor-lymph node-metastasis (TNM) staging (2017, 8th edition). This study was approved by the Ethics Committee of Human Research of Ningbo University (No.KY2015PJ012). Written informed consent was provided by all subjects.
Total RNA preparation and synthesis of cDNA
The TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and TRIzol LS reagents (Invitrogen) was used to extract the total RNA of tissues/cells and plasma through the SmartSpec Plus spectrophotometer (BioRad, Hercules, CA, USA). The purity and concentration of total RNA were determined. The RNA quality control standards were as follows: A260:A230 ratio > 1.7; A260:A280 ratio 1.8–2.1. According to the rtStar™ tRNA-optimized First-Strand cDNA Synthesis Kit (Arraystar, Rockville,MD, USA) instructions, 2 µg of total RNA was used for demethylation reactions and cDNA synthesis. For assessing the quality of synthetic cDNA, 1 µl of RNA Spike-in quantitative polymerase chain reaction (qPCR) Primer Mix, use µl cDNA, 2 5 µl GoTaq qPCR Mixture (Promega, Madison, WI, USA) and 2 µl of enzyme-free water were added; only samples with cycle threshold (Ct) values < 30 were used for qPCR detection.
qPCR
The cDNA was diluted with enzyme-free water (1:20). The Applied Biosystems 7900 real-time PCR system (Thermo-Fisher, USA) was used to qPCR. 88 kinds of tRNA primers were bought from Arraystar,Inc,Rockville,MD,USA. U6 was used as a control, and the relative expression level of tRNA was determined by the ΔΔCt method. U6 primers were purchased from BGI (Shanghai, China). The U6 sequences were as follows: justice, 5'- GCTTCGGCAGCACATATACTAAAAT-3'; Antimony 5'- CGCTTCACGAATTTGCGTCAT-3'.
Cell culture and transfection
The LSCC cell line AMC-HN-8 was purchased from BeNa Culture Collection, Shanghai, China. The cells were cultured in RPMI 1640 (HyClone, Logan, UT, USA) 10% fetal bovine serum (PAN Biotech, Aidenbach, Germany) at 37 °C and 5% CO2. Cells were counted using a TC10 automatic cell counter (BioRad). The lentivirus was purchased from GenePharma (Shanghai, China). Stably transfected cells were selected through purine mycin. The tRNAIniCAT of the overexpression lentivirus is termed LV3-tRNAIniCAT. Sequences: 5'- AGCAGAGTGGCG CAGCGGAAGCGTGCTGGGCCCATAACCCAGAGGTCGATGGATCGAAACCATCCTCTGCTA-3', LV3-NC used as a control, sequence: 5'- TTCTCCGAACGTGTCACGT-3'.
Cell inhibition rate test
AMC-HN-8 cells were digested with trypsin to form a single-cell suspension and inoculated on a six-well plate. A culture medium containing 3 H-TdR was added for 16 h, and the cells were digested and collected. Finally, a Micro Beta 2450 liquid scintillation counter (Perkin Elmer,Waltham, Mass, USA) was used to determine the minutes (cpm), and the inhibition rate was calculated by the average cpm of three wells.
Cell cycle and apoptosis analysis
The cells were starved (serum) to synchronize the cell cycle. Subsequently, the cells were collected, washed with phosphate-buffered saline, and fixed in 70% ethanol at − 20 °C for 24 h. Next, staining with DNA dye solution was performed using the Cell Cycle Detection Kit (KeyGEN, Jiangsu, China), and the cells were incubated for 30 min. Lastly, BD FACSCanto II flow cytometry (BD Biosciences, San Jose, CA, USA) Testing was performed. Cells were digested with trypsin (no ethylenediaminetetraacetic acid) into a single-cell suspension, and resuspended in binding buffer. The cells were then stored at room temperature. Using an Annexin V-FITC/PI apoptosis kit (CoWin Biosciences, Beijing, China), the cells were stained for 15 min without light, and the rate of apoptosis was detected using BD FACSCanto II flow cytometry (BD Biosciences).
Mouse models of xenotransplantation
All animal studies were conducted in accordance with the animal protocol approved by the animal protection and use committee of Zhejiang University of Traditional Chinese Medicine (No.2019-007),Hangzhou, Zhejiang, China. BALB/c female nude mice were purchased from Charles River (Beijing, China) and raised in the experimental animal center of Zhejiang University of Traditional Chinese Medicine. The mice were anesthetized with pentobarbital sodium (45 mg/kg); the laryngeal skin was removed and the larynx was inoculated with AMC-HN-8-Luc cell suspension. The mice were randomly divided into three groups (9 or 10 mice per group). Tumor growth was observed using an IVIS Lumina XRMS small animal in vivo imager (Perkin Elmer) after 1 week. The mice in each group were injected with 50 µl of corresponding medicine solution within the tumor (twice per week for 21 consecutive days). The weight and tumor volume in mice were measured twice per week. The following day, the mice were sacrificed, and the solid tumor was resected and weighed. Conventional hematoxylin-eosin pathological examination and electron microscopy were performed on the tumor tissue.
Staining and TEM of hematoxylin-eosin
The tumor tissue was fixed in 10% formalin, embedded in paraffin, cut into sections (thickness: 8 µm) and baked at 45 °C for 5 h. Subsequently, the tissues were dewaxed with xylene for 30 min, treated with different concentrations of ethanol (100%, 90%, 70%); hydrated with distilled water, stained with hematoxylin for 15 min, differentiated in ethanol and ammonia, dehydrated with ethanol, stained with eosin, dehydrated again with ethanol, and washed with xylene. Tissue morphology was observed by optical microscopy. The tumor tissue was fixed with 2.5% glutaraldehyde for 1 h and washed with phosphate-buffered saline for 1 h. The tumor tissue was subsequently fixed in 1% osmium acid for 30 min–1 h, and dehydrated in ethanol and acetone. Finally, the tissue was embedded in epoxy resin and stained with uranyl acetate and lead citrate. The Hitachi H-7650 TEM (Tokyo, Japan) was used to observe the changes in autophagy and apoptosis morphology.
Statistical analysis
The SPSS version 20.0 software (IBM Corp., Armonk, NY, USA) and GraphPad 8.0 (San Diego, CA, USA) were used for data analysis. The relative expression level of tRNAIniCAT between LSCC tissues and adjacent non-tumor tissues was analyzed by paired sample t test. One-way analysis of variance was used to analyze the level of tRNAIniCAT expression in the preoperative plasma, postoperative plasma, and plasma of patients with LSCC. The correlation between the expression level and clinicopathological factors was analyzed using the chi-squared test. The diagnostic value was assessed using the Receiver operating characteristic curve (ROC). P-values < 0.05 denoted statistically significant differences.
Differences in tRNA expression in LSCC and adjacent tissues
The cDNA microarray results indicated that the expression levels of 88 tRNA (including intracellular tRNA and mitochondrial tRNA) in LSCC and paracancerous tissues were detected in eight pairs. The results showed that the expression profiles of tRNA in LSCC tissues were different from those observed in adjacent tissues (Figs. 1 and 2). We found that two tRNA doubled their expression levels in LSCC and paracancerous tissues: tRNAIniCAT (2.24-fold change) and mt-tRNAGlu TTC (− 2.21-fold change). Meanwhile, the first 20 tRNA had higher expression levels in LSCC than in adjacent tissues and were all intracytoplasmic tRNA. In contrast, 18 of the first 20 tRNA with lower expression in LSCC tissues than in adjacent tissues were mitochondrial tRNA (Figs. 3 and 4).
Low expression of tRNAIniCAT in LSCC tissues
To validate the results of the PCR array, tumor and paracancerous tissue samples were collected from a total of 100 patients with LSCC through quantitative reverse-transcription PCR to determine the relative expression levels of tRNAIniCAT. However, as shown in Fig. 5, the expression levels of tRNAIniCAT in tumor tissues were significantly lower than those measured in adjacent paracancerous tissues (p = 0.0077). Among those, the expression levels of tRNAIniCAT in 63 LSCC tissues (63%) were lower than those recorded in the corresponding paracancerous tissues (Fig. 6).
tRNAIniCAT in plasma of patients with LSCC was downregulated
By exploring the relative expression levels of tRNAIniCAT in plasma, we obtained consistent results with those reported for tumor tissues. The expression levels of tRNAIniCAT in the preoperative plasma of patients with LSCC were significantly lower than those noted in postoperative plasma (p = 0.0032) and healthy human plasma (p < 0.0001). Meanwhile, the expression levels in postoperative plasma were significantly lower than those observed in healthy human plasma (p = 0.0458) (Fig. 7).
tRNAIniCAT expression levels and clinicopathological characteristics of patients with LSCC and potential diagnostic value
Tissues were divided into low and high expression groups according to the expression levels of tRNAIniCAT. Subsequently, we analyzed the relationship between the expression levels of tRNAIniCAT and clinicopathological factors. The results showed that the expression levels of tRNAIniCAT were not associated with clinicopathological features (Table 1). The area under the ROC curve for tRNAIniCAT in tissues and plasma was 0.575 and 0.808, respectively (Fig. 8).
|
Characteristics |
n (%) |
Low (%) |
High (%) |
P-value |
|---|---|---|---|---|
|
All cases |
86 (100) |
56 (65.1) |
30 (34.9) |
|
|
Age, years |
0.949 |
|||
|
≤ 60 |
34 (39.5) |
22 (39.3) |
12 (40) |
|
|
> 60 |
52 (60.5) |
34 (60.7) |
18 (60) |
|
|
Primary location |
0.851 |
|||
|
Supraglottic |
24 (27.9) |
16 (28.6) |
8 (26.7) |
|
|
Glottic |
62 (72.1) |
40 (71.4) |
22 (73.3) |
|
|
Differentiation |
0.732 |
|||
|
Well & moderate |
67 (77.9) |
43 (76.8) |
24 (80) |
|
|
Poor |
19 (22.1) |
13 (23.2) |
6 (20) |
|
|
Lymphatic metastasis |
0.571 |
|||
|
N0 |
75 (87.2) |
45 (85.7) |
27 (90) |
|
|
N1–N3 |
11 (12.8) |
8 (14.3) |
3 (10) |
|
|
Invasion |
0.949 |
|||
|
T1–T2 |
52 (60.5) |
34 (60.7) |
18 (60) |
|
|
T3–T4 |
34 (39.5) |
22 (39.3) |
12 (40) |
|
|
Clinical stage |
0.907 |
|||
|
I–II |
48 (55.8) |
31 (55.4) |
17 (56.7) |
|
|
III–IV |
38 (44.2) |
25 (44.6) |
13 (43.3) |
|
|
Smoking history |
0.701 |
|||
|
Yes |
55 (64) |
35 (62.5) |
20 (66.7) |
|
|
No |
31 (36) |
21 (37.5) |
10 (33.3) |
|
| Ct, cycle threshold; LSCC, laryngeal squamous cell carcinoma | ||||
High expression of tRNAIniCAT inhibits LSCC cell growth
AMC-HN-8 cells were transfected using LV3-tRNAIniCAT to upregulate tRNAIniCAT and negative control (LV3-NC) to assess the role of tRNAIniCAT in tumor progression. Following transfection of LV3-tRNAIniCAT and LV3-NC in AMC-HN-8 cells, green fluorescent protein fluorescence expression was observed (Fig. 9). The levels of tRNAIniCAT in the cells showed a 2.1-fold increase (Fig. 10). A cell inhibition rate analysis was performed to determine the effect of tRNAIniCAT on LSCC cell inhibition. The results showed that overexpression of tRNAIniCAT significantly inhibited cell growth compared with the NC group (Fig. 11).
Effects of tRNAIniCAT on cell cycle and apoptosis
For further exploration of the potential regulatory mechanisms of tRNAIniCAT in cell proliferation, cell cycle and apoptosis were assessed by flow cytometry. The upregulated tRNAIniCAT did not have a significant effect on the cell cycle (Fig. 12). Furthermore, the results of the apoptosis analysis showed that transfection of LV3-tRNAIniCAT significantly promoted apoptosis in AMC-HN-8 cells (Fig. 13). Collectively, these results indicated that tRNAIniCAT promoted apoptosis.
tRNAIniCAT inhibits growth of LSCC xenograft
We used an in vivo xenograft mouse model to investigate the role of tRNAIniCAT in inhibiting cancer. The mice were divided into three groups: LV3-tRNAIniCAT (high and low doses) and LV3-NC (Fig. 14). The results indicated that upregulation of tRNAIniCAT significantly inhibited tumor growth (Fig. 15). Among them, the weight of the transplanted tumor in the high dose group was significantly smaller than that in the NC group. During the experiment, there was no significant difference in tumor volume and mouse weight in these groups (Figs. 16 and 17). Pathological findings indicated that the administration of LV3-tRNAIniCAT significantly increased tissue necrosis in nude mice transplanted with tumors, showing a certain role of tRNAIniCAT in promoting apoptosis (Fig. 18). Through TEM, apoptotic cells were shown to have special structural characteristics. The autophagy and apoptosis of the tumor in the LV3-tRNAIniCAT treatment group were significantly increased, the phagocytic structure in the bubble was upgraded, and the nucleus had slightly shrunk (Fig. 19). Therefore, we concluded that tRNAIniCAT promotes LSCC cell apoptosis in vivo.
The expression spectrum of early LSCC mainly focused on mRNA and miRNA, such as DJ-1,12 HuR,13 and miR-34a,14 which were found to be associated with this disease. In the current study using gene chip technology, the expression profiles of tRNA in LSCC and normal tissues were found to differ. This study provides a complete expression profile of tRNA in LSCC.
tRNA was widely regarded as a housekeeping gene with limited regulatory function. There are only few tRNA with known additional functions,15 other than their usefulness as adapters for protein synthesis. In recent years, a growing body of evidence suggests that tRNA and its derivatives are dysregulated and participate in the pathogenic process of cancer.16 Mutations in tRNA and the involvement of co-oproteins produced by tRNA biogenesis and modification were found to be associated with cancer.17–19 Studies have found that tRNA synthesis was controlled by various oncogenic and tumor suppressor genes. Ras20 and c-Myc 21 facilitate RNA Pol III transcription; however, Rb22 and p5323 inhibit RNA Pol III transcription, leading to severe dysregulation of tRNA levels in multiple types of cancer. In addition, in several types of cancer, tRNA modified enzymes can add some tRNA modification, which changes their codon preferences and leads to an increase in protein expression levels of mRNA with "preference" codons.24, 25 Meanwhile, mutations in mitochondrial tRNA cause mitochondrial dysfunction which is also associated with tumorigenesis.26
Contrary to the profiling result, the present study confirmed the relative levels of tRNAIniCAT expression in 100 pairs of paired tissue samples, and revealed that tRNAIniCAT expression in LSCC tissues was downregulated (Fig. 5). tRNAIniCAT was downregulated in LSCC preoperative plasma compared with postoperative plasma; this finding was consistent with the results obtained in tissues (Fig. 7). Moreover, this study demonstrated that tRNAIniCAT may act as tumor inhibitor in LSCC in vitro and in vivo. Firstly, we used a LV3-tRNAIniCAT lentivirus to upregulate tRNAIniCAT in LSCC cells (Fig. 10). Cell inhibition rate analysis was conducted to determine the effect of tRNAIniCAT overexpression on cell proliferation. The data showed that overexpression of tRNAIniCAT inhibited cell growth (Fig. 11). Moreover, cell cycle and apoptosis were evaluated to further investigate the biological functions of tRNAIniCAT in LSCC cells. The results showed that the upregulation of tRNAIniCAT did not significantly affect the cell cycle (Fig. 12). However, overexpression of tRNAIniCAT improved the rate of apoptosis in treated AMC-HN-8 cells (Fig. 13). Lastly, we reached the same conclusion based on experiments in BALB/c mouse xenografts; tRNAIniCAT inhibited tumor growth and promoted tumor cell apoptosis in vivo. Overexpression of tRNAIniCAT significantly decreased the tumor weight of the xenografts (Fig. 15). By pathological examination and TEM, we found that overexpression of tRNAIniCAT significantly increased tumor cell apoptosis and autophagy (Figs. 18 and 19).
The findings of this study are consistent with those of previous studies. Numerous studies have confirmed the important role of tRNA in regulating gene expression. Change in bacterial activity tRNA content plays an adaptive role with environmental signal changes.27 The binding of tRNA to cytochrome C inhibits the effects of cytochrome C and apoptotic proteases, thereby inhibiting apoptosis and enzyme activity .28 Overexpression of the initial tRNA (tRNAiMet) was observed in normal mammary epithelial cells. Changes in the whole cell tRNA expression levels accelerate the speed of cell proliferation.29 In carcinoma-associated fibroblasts, tRNAiMet promotes tumor proliferation and angiogenesis.30 Studies revealed that tRNAIle expression was higher in breast cancer-associated fibroblasts than in normal fibroblasts .30,31 These abnormally expressed tRNA molecules are expected to be new prognostic markers for such diseases.32 tRNAGluUUC and tRNAArgCCG are highly expressed in breast cancer and enhance tumor invasion. EXOSC2 and GRIPAP1 are downstream target proteins of tRNAGluUUC to promote the progression of cancer invasion and metastasis.33 In human epidermal growth factor receptor 2-positive breast cancer cell lines, free tRNALeu may interact with human epidermal growth factor receptor 3 (ErbB3) and binding protein (EBP1), which in turn activates the ErbB2/ErbB3 signaling pathways, and ultimately promotes cancer cell proliferation.34 tRNA plays a key role in translation, and its dysregulation may affect cell protein expression. Cancer cells regulate the expression of multiple promoters of cancer progression by regulating the levels of tRNA. This leads to the notion that cancer cells exhibit tRNA regulatory effects in addition to the numerous known regulatory mechanisms that alter the expression of cancer progression promoters. Disorders of tRNAIniCAT we found in LSCC may cause dysregulation of downstream target protein expression, which in turn changes the ability of tumor proliferation and apoptosis.
The present study provides a comprehensive tRNA expression spectrum for LSCC. The novel tRNAIniCAT can inhibit the proliferation of LSCC cells and promote apoptosis in vitro and in vivo. Studies show that tRNAIniCAT may be a diagnostic biomarker and a potential therapeutic target in LSCC.
LSCC, laryngeal squamous cell carcinoma; qRT-PCR, quantitative real-time polymerase chain reaction; tRNA,transfer RNA; TEM,transmission electron microscopy; ROC,Receiver operating characteristic curve.
Ethics approval and consent to participate
This study was approved by the Ethics Committee of Human Research of Ningbo University,Ningbo, Zhejiang, China.This study was approved by the Animal Ethical Care and Use Committee of Zhejiang University of Traditional Chinese Medicine,Hangzhou, Zhejiang, China.
Availability of data and material
The datasets used and analyzed during the current study are available from the corresponding author upon request.
Funding
This work was supported by grants from Ningbo Health Branding Subject Fund (PPXK2018-02), the Natural Science Foundation of Zhejiang(Grant No. LY20H130001),the Natural Science Foundation of Ningbo (Grant Nos. 2017A610236; 2018A610361;2019A610319),
the Leading and Top Talents Training Projects of Ningbo (NBLJ201801032), and the Medical and Health Training Project of Zhejiang Province (Grant Nos. 2015RCB025; 2018RC063).
Competing interests
The authors report no conflicts of interest in this work.
Authors' contributions
All authors contributed to data analysis, drafting or revising the article, gave final approval of the version to be published, and agree to be accountable for all aspects of the work.
Consent for publication
Authors involved in this paper all signed written consent for publishing
Acknowledgements
We thank all those who participated in this study
- Ribeiro El-Achkar VN, Duarte A, Pinto Saggioro F, De Mello Filho FV, León JE, Ribeiro-Silva A, Kaminagakura E: Squamous Cell Carcinoma Originating from Adult Laryngeal Papillomatosis: Case Report and Review of the Literature. Case reports in otolaryngology 2018, 2018:4362162.
- Fusconi M, Campo F, Gallo A, Zambetti G, Martellucci S, Seccia A, de Vincentiis M: Laryngeal Cancer, HPV DNA vs E6/E7 mRNA Test: A Systematic Review. Journal of voice : official journal of the Voice Foundation 2017, 31(2):248.e241-248.e245.
- Shen Y, Yu X, Zhu L, Li T, Yan Z, Guo J: Transfer RNA-derived fragments and tRNA halves: biogenesis, biological functions and their roles in diseases. Journal of molecular medicine (Berlin, Germany) 2018, 96(11):1167-1176.
- Giegé R: Toward a more complete view of tRNA biology. Nature structural & molecular biology 2008, 15(10):1007-1014.
- Rodnina MV, Wintermeyer W: The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation. Biochemical Society transactions 2011, 39(2):658-662.
- Boccaletto P, Machnicka MA, Purta E, Piatkowski P, Baginski B, Wirecki TK, de Crécy-Lagard V, Ross R, Limbach PA, Kotter A et al: MODOMICS: a database of RNA modification pathways. 2017 update. Nucleic acids research 2018, 46(D1):D303-d307.
- Oerum S, Dégut C, Barraud P, Tisné C: m1A Post-Transcriptional Modification in tRNAs. Biomolecules 2017, 7(1).
- Pavon-Eternod M, Gomes S, Geslain R, Dai Q, Rosner MR, Pan T: tRNA over-expression in breast cancer and functional consequences. Nucleic acids research 2009, 37(21):7268-7280.
- Huang SQ, Sun B, Xiong ZP, Shu Y, Zhou HH, Zhang W, Xiong J, Li Q: The dysregulation of tRNAs and tRNA derivatives in cancer. Journal of experimental & clinical cancer research : CR 2018, 37(1):101.
- Tuorto F, Parlato R: rRNA and tRNA Bridges to Neuronal Homeostasis in Health and Disease. Journal of molecular biology 2019, 431(9):1763-1779.
- Zhou Z, Sun B, Huang S, Jia W, Yu D: The tRNA-associated dysregulation in diabetes mellitus. Metabolism: clinical and experimental 2019, 94:9-17.
- Shen Z, Jiang Z, Ye D, Xiao B, Zhang X, Guo J: Growth inhibitory effects of DJ-1-small interfering RNA on laryngeal carcinoma Hep-2 cells. Medical oncology (Northwood, London, England) 2011, 28(2):601-607.
- Shen Z, Ye D, Zhang X, Jiang Z, Xiao B, Guo J: Inhibitory effect of HuR gene small interfering RNA segment on laryngeal carcinoma Hep-2 cell growth. The Journal of laryngology and otology 2010, 124(11):1183-1189.
- Shen Z, Zhan G, Ye D, Ren Y, Cheng L, Wu Z, Guo J: MicroRNA-34a affects the occurrence of laryngeal squamous cell carcinoma by targeting the antiapoptotic gene survivin. Medical oncology (Northwood, London, England) 2012, 29(4):2473-2480.
- Grewal SS: Why should cancer biologists care about tRNAs? tRNA synthesis, mRNA translation and the control of growth. Biochimica et biophysica acta 2015, 1849(7):898-907.
- Anderson P, Ivanov P: tRNA fragments in human health and disease. FEBS letters 2014, 588(23):4297-4304.
- Blanco S, Frye M: Role of RNA methyltransferases in tissue renewal and pathology. Current opinion in cell biology 2014, 31:1-7.
- Suzuki T, Nagao A, Suzuki T: Human mitochondrial tRNAs: biogenesis, function, structural aspects, and diseases. Annual review of genetics 2011, 45:299-329.
- Yao P, Fox PL: Aminoacyl-tRNA synthetases in medicine and disease. EMBO molecular medicine 2013, 5(3):332-343.
- Wang HD, Trivedi A, Johnson DL: Hepatitis B virus X protein induces RNA polymerase III-dependent gene transcription and increases cellular TATA-binding protein by activating the Ras signaling pathway. Molecular and cellular biology 1997, 17(12):6838-6846.
- Gomez-Roman N, Grandori C, Eisenman RN, White RJ: Direct activation of RNA polymerase III transcription by c-Myc. Nature 2003, 421(6920):290-294.
- White RJ, Trouche D, Martin K, Jackson SP, Kouzarides T: Repression of RNA polymerase III transcription by the retinoblastoma protein. Nature 1996, 382(6586):88-90.
- Crighton D, Woiwode A, Zhang C, Mandavia N, Morton JP, Warnock LJ, Milner J, White RJ, Johnson DL: p53 represses RNA polymerase III transcription by targeting TBP and inhibiting promoter occupancy by TFIIIB. The EMBO journal 2003, 22(11):2810-2820.
- Novoa EM, Pavon-Eternod M, Pan T, Ribas de Pouplana L: A role for tRNA modifications in genome structure and codon usage. Cell 2012, 149(1):202-213.
- Novoa EM, Ribas de Pouplana L: Speeding with control: codon usage, tRNAs, and ribosomes. Trends in genetics : TIG 2012, 28(11):574-581.
- Florentz C, Sohm B, Tryoen-Tóth P, Pütz J, Sissler M: Human mitochondrial tRNAs in health and disease. Cellular and molecular life sciences : CMLS 2003, 60(7):1356-1375.
- Subramaniam AR, Pan T, Cluzel P: Environmental perturbations lift the degeneracy of the genetic code to regulate protein levels in bacteria. Proceedings of the National Academy of Sciences of the United States of America 2013, 110(6):2419-2424.
- Mei Y, Yong J, Liu H, Shi Y, Meinkoth J, Dreyfuss G, Yang X: tRNA binds to cytochrome c and inhibits caspase activation. Molecular cell 2010, 37(5):668-678.
- Pavon-Eternod M, Gomes S, Rosner MR, Pan T: Overexpression of initiator methionine tRNA leads to global reprogramming of tRNA expression and increased proliferation in human epithelial cells. RNA (New York, NY) 2013, 19(4):461-466.
- Clarke CJ, Berg TJ, Birch J, Ennis D, Mitchell L, Cloix C, Campbell A, Sumpton D, Nixon C, Campbell K et al: The Initiator Methionine tRNA Drives Secretion of Type II Collagen from Stromal Fibroblasts to Promote Tumor Growth and Angiogenesis. Current biology : CB 2016, 26(6):755-765.
- Kojima Y, Acar A, Eaton EN, Mellody KT, Scheel C, Ben-Porath I, Onder TT, Wang ZC, Richardson AL, Weinberg RA et al: Autocrine TGF-beta and stromal cell-derived factor-1 (SDF-1) signaling drives the evolution of tumor-promoting mammary stromal myofibroblasts. Proceedings of the National Academy of Sciences of the United States of America 2010, 107(46):20009-20014.
- Krishnan P, Ghosh S, Wang B, Heyns M, Li D, Mackey JR, Kovalchuk O, Damaraju S: Genome-wide profiling of transfer RNAs and their role as novel prognostic markers for breast cancer. Scientific reports 2016, 6:32843.
- Goodarzi H, Nguyen HCB, Zhang S, Dill BD, Molina H, Tavazoie SF: Modulated Expression of Specific tRNAs Drives Gene Expression and Cancer Progression. Cell 2016, 165(6):1416-1427.
- Kwon NH, Lee MR, Kong J, Park SK, Hwang BJ, Kim BG, Lee ES, Moon HG, Kim S: Transfer-RNA-mediated enhancement of ribosomal proteins S6 kinases signaling for cell proliferation. RNA biology 2018, 15(4-5):635-648.
Badges
Prescreen
This manuscript passed our Prescreen assessment
Complete author information
Appropriate declaration statements
Potential risks to human health
Prescreen
History
CURRENT STATUS: Posted
Version 1
Posted 21 Sep, 2020
No community comments so far
Metrics
Comments: 0
PDF Downloads: ...
HTML Views: ...
Learn more about our company.
This is a preprint. It has not completed peer review.
Primary research
tRNA Ini CAT inhibits proliferation and promotes apoptosis of laryngeal squamous cell carcinoma cell
Zhisen Shen
Ningbo Medical Treatment Centre Li Huili Hospital
Corresponding Author
ORCiD: https://orcid.org/0000-0001-6660-0488
Badges
Prescreen
This manuscript passed our Prescreen assessment
Complete author information
Appropriate declaration statements
Potential risks to human health
Prescreen
History
CURRENT STATUS: Posted
Version 1
Posted 21 Sep, 2020
No community comments so far
Metrics
Comments: 0
PDF Downloads: ...
HTML Views: ...
License:
This work is licensed under a CC BY 4.0 License. Read Full License
Background: Transfer RNA (tRNA) is a ubiquitous RNA, present in all life forms and considered a housekeeping gene with limited regulatory function. Recent studies have shown that tRNA is dysregulated and involved in the pathogenic process of cancer.
Methods: Quantitative reverse transcription-polymerase chain reaction detected the relative expression levels of tRNAIniCAT in paired LSCC tissues and paracancerous tissues and preoperative, postoperative, and healthy human plasma. We analyzed the relationship between its expression level and the clinicopathological features of patients. We also established the receiver operating characteristic curve and predicted its diagnostic value. High expression of tRNAIniCAT was detected in the LSCC cell line. The proliferation, apoptosis, and cycle of cells were analyzed. High expression of tRNAIniCAT was detected in mice with transplanted tumors. The tumor weight and volume in mice were measured. The transplanted tumor was used for pathological analysis and transmission electron microscope observation.
Results: tRNAIniCAT was down-regulated in LSCC tissues and plasma. The area under the plasma receiver operating characteristic curve was 0.808. High expression of tRNAIniCAT in the laryngeal carcinoma cell line inhibited cell proliferation and promoted apoptosis. High expression of tRNAIniCAT in transplanted tumor in nude mice inhibited the growth of the transplanted tumor.
Conclusion: tRNAIniCAT acts as a tumor Inhibitor in LSCC, inhibits cell proliferation, and promotes apoptosis in vitro and in vivo. tRNAIniCAT may be used as a new biomarker for the early diagnosis of LSCC.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16
Figure 17
Figure 18
Figure 19
Laryngeal cancer is a common malignant tumor of the head and neck. It is common among men aged 50–70 years. Its incidence is 1.5–3/100,000, accounting for approximately 1% of all malignant tumors. Laryngeal squamous cell carcinoma (LSCC) is the most common type, accounting for approximately 90% of cases.1 At present, the incidence of laryngeal cancer is increasing. Treatment is mainly through surgical resection, combined with preoperative or postoperative chemotherapy, radiotherapy, and other comprehensive therapies. However, vocal disorders occur following surgery, affecting the quality of life of patients. Globally, more than 80,000 patients with throat cancer expire each year.2
Transfer RNA (tRNA) is a universal RNA present in all forms of life. A mature tRNA is characterized by its secondary structure, which consists of a D ring, a counterpasser ring, a variable ring, a T ring, and an receiving arm, as well as an L tertiary structure maintained by hydrogen bonds.3 As a basic component of the translation process, tRNA transport amino acids to the ribosome; the genetic information of the nucleotide sequence is transformed into the corresponding polypeptide chain in the manner of codon (mRNA)-anti-crypton (tRNA) interaction; 4, 5 this process is essential to maintain the normal life activities of the body. More than half of RNA modifications occur in tRNA.6 These modifications affect the structure, stability, and functionality of tRNA, leading to widespread cellular effects; of those, methylation modification is the most common effect .7
Early studies reported that tRNA plays only the role of a "porter", and does not possess regulatory function. Nevertheless, as research progresses, tRNA have been found to be involved in various physiological and pathological processes, including cancer, diabetes, and neuronal disease .8–11 The role of tRNA in LSCC remains unknown and there is no complete tRNA expression map on this disease. This study established tRNA expression profiles from eight pairs of LSCC and paracancerous tissues via a microarray platform. In addition, the relative expression levels of tRNAIniCAT in tumor and paracancerous tissues, preoperative and postoperative plasma of patients with LSCC and plasma of healthy human were examined. The tRNAIniCAT was analyzed to determine the relationship between its expression level and clinicopathological features. The work characteristic curves of the subjects were established to predict their diagnostic value. The tRNAIniCAT was upregulated in laryngeal cancer cell lines. The proliferation, apoptosis, and cycle of cells were analyzed. High expression of tRNAIniCAT was observed in mice transplanted with tumors. The tumor weight and volume in mice were measured, and the tumors were analyzed by pathology and transmission electron microscopy (TEM). Finally, the usefulness of tRNAIniCAT as biomarker and potential therapeutic target for LSCC was examined.
Collection of specimens and clinical data
Patients with LSCC who underwent otorhinolaryngology and head and neck surgery at Li Huili Hospital affiliated to Ningbo University (Ningbo, China) from January 2013 to April 2019 without receiving radiotherapy, chemotherapy, or other antitumor treatments were selected. Tumor tissue and paracancerous tissue samples were obtained from surgery. All LSCC samples were confirmed by at least two senior pathology experts. Healthy human plasma samples were used to obtain plasma samples before and after surgery. Tumor staging was determined according to the American Joint Committee on Cancer tumor-lymph node-metastasis (TNM) staging (2017, 8th edition). This study was approved by the Ethics Committee of Human Research of Ningbo University (No.KY2015PJ012). Written informed consent was provided by all subjects.
Total RNA preparation and synthesis of cDNA
The TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and TRIzol LS reagents (Invitrogen) was used to extract the total RNA of tissues/cells and plasma through the SmartSpec Plus spectrophotometer (BioRad, Hercules, CA, USA). The purity and concentration of total RNA were determined. The RNA quality control standards were as follows: A260:A230 ratio > 1.7; A260:A280 ratio 1.8–2.1. According to the rtStar™ tRNA-optimized First-Strand cDNA Synthesis Kit (Arraystar, Rockville,MD, USA) instructions, 2 µg of total RNA was used for demethylation reactions and cDNA synthesis. For assessing the quality of synthetic cDNA, 1 µl of RNA Spike-in quantitative polymerase chain reaction (qPCR) Primer Mix, use µl cDNA, 2 5 µl GoTaq qPCR Mixture (Promega, Madison, WI, USA) and 2 µl of enzyme-free water were added; only samples with cycle threshold (Ct) values < 30 were used for qPCR detection.
qPCR
The cDNA was diluted with enzyme-free water (1:20). The Applied Biosystems 7900 real-time PCR system (Thermo-Fisher, USA) was used to qPCR. 88 kinds of tRNA primers were bought from Arraystar,Inc,Rockville,MD,USA. U6 was used as a control, and the relative expression level of tRNA was determined by the ΔΔCt method. U6 primers were purchased from BGI (Shanghai, China). The U6 sequences were as follows: justice, 5'- GCTTCGGCAGCACATATACTAAAAT-3'; Antimony 5'- CGCTTCACGAATTTGCGTCAT-3'.
Cell culture and transfection
The LSCC cell line AMC-HN-8 was purchased from BeNa Culture Collection, Shanghai, China. The cells were cultured in RPMI 1640 (HyClone, Logan, UT, USA) 10% fetal bovine serum (PAN Biotech, Aidenbach, Germany) at 37 °C and 5% CO2. Cells were counted using a TC10 automatic cell counter (BioRad). The lentivirus was purchased from GenePharma (Shanghai, China). Stably transfected cells were selected through purine mycin. The tRNAIniCAT of the overexpression lentivirus is termed LV3-tRNAIniCAT. Sequences: 5'- AGCAGAGTGGCG CAGCGGAAGCGTGCTGGGCCCATAACCCAGAGGTCGATGGATCGAAACCATCCTCTGCTA-3', LV3-NC used as a control, sequence: 5'- TTCTCCGAACGTGTCACGT-3'.
Cell inhibition rate test
AMC-HN-8 cells were digested with trypsin to form a single-cell suspension and inoculated on a six-well plate. A culture medium containing 3 H-TdR was added for 16 h, and the cells were digested and collected. Finally, a Micro Beta 2450 liquid scintillation counter (Perkin Elmer,Waltham, Mass, USA) was used to determine the minutes (cpm), and the inhibition rate was calculated by the average cpm of three wells.
Cell cycle and apoptosis analysis
The cells were starved (serum) to synchronize the cell cycle. Subsequently, the cells were collected, washed with phosphate-buffered saline, and fixed in 70% ethanol at − 20 °C for 24 h. Next, staining with DNA dye solution was performed using the Cell Cycle Detection Kit (KeyGEN, Jiangsu, China), and the cells were incubated for 30 min. Lastly, BD FACSCanto II flow cytometry (BD Biosciences, San Jose, CA, USA) Testing was performed. Cells were digested with trypsin (no ethylenediaminetetraacetic acid) into a single-cell suspension, and resuspended in binding buffer. The cells were then stored at room temperature. Using an Annexin V-FITC/PI apoptosis kit (CoWin Biosciences, Beijing, China), the cells were stained for 15 min without light, and the rate of apoptosis was detected using BD FACSCanto II flow cytometry (BD Biosciences).
Mouse models of xenotransplantation
All animal studies were conducted in accordance with the animal protocol approved by the animal protection and use committee of Zhejiang University of Traditional Chinese Medicine (No.2019-007),Hangzhou, Zhejiang, China. BALB/c female nude mice were purchased from Charles River (Beijing, China) and raised in the experimental animal center of Zhejiang University of Traditional Chinese Medicine. The mice were anesthetized with pentobarbital sodium (45 mg/kg); the laryngeal skin was removed and the larynx was inoculated with AMC-HN-8-Luc cell suspension. The mice were randomly divided into three groups (9 or 10 mice per group). Tumor growth was observed using an IVIS Lumina XRMS small animal in vivo imager (Perkin Elmer) after 1 week. The mice in each group were injected with 50 µl of corresponding medicine solution within the tumor (twice per week for 21 consecutive days). The weight and tumor volume in mice were measured twice per week. The following day, the mice were sacrificed, and the solid tumor was resected and weighed. Conventional hematoxylin-eosin pathological examination and electron microscopy were performed on the tumor tissue.
Staining and TEM of hematoxylin-eosin
The tumor tissue was fixed in 10% formalin, embedded in paraffin, cut into sections (thickness: 8 µm) and baked at 45 °C for 5 h. Subsequently, the tissues were dewaxed with xylene for 30 min, treated with different concentrations of ethanol (100%, 90%, 70%); hydrated with distilled water, stained with hematoxylin for 15 min, differentiated in ethanol and ammonia, dehydrated with ethanol, stained with eosin, dehydrated again with ethanol, and washed with xylene. Tissue morphology was observed by optical microscopy. The tumor tissue was fixed with 2.5% glutaraldehyde for 1 h and washed with phosphate-buffered saline for 1 h. The tumor tissue was subsequently fixed in 1% osmium acid for 30 min–1 h, and dehydrated in ethanol and acetone. Finally, the tissue was embedded in epoxy resin and stained with uranyl acetate and lead citrate. The Hitachi H-7650 TEM (Tokyo, Japan) was used to observe the changes in autophagy and apoptosis morphology.
Statistical analysis
The SPSS version 20.0 software (IBM Corp., Armonk, NY, USA) and GraphPad 8.0 (San Diego, CA, USA) were used for data analysis. The relative expression level of tRNAIniCAT between LSCC tissues and adjacent non-tumor tissues was analyzed by paired sample t test. One-way analysis of variance was used to analyze the level of tRNAIniCAT expression in the preoperative plasma, postoperative plasma, and plasma of patients with LSCC. The correlation between the expression level and clinicopathological factors was analyzed using the chi-squared test. The diagnostic value was assessed using the Receiver operating characteristic curve (ROC). P-values < 0.05 denoted statistically significant differences.
Differences in tRNA expression in LSCC and adjacent tissues
The cDNA microarray results indicated that the expression levels of 88 tRNA (including intracellular tRNA and mitochondrial tRNA) in LSCC and paracancerous tissues were detected in eight pairs. The results showed that the expression profiles of tRNA in LSCC tissues were different from those observed in adjacent tissues (Figs. 1 and 2). We found that two tRNA doubled their expression levels in LSCC and paracancerous tissues: tRNAIniCAT (2.24-fold change) and mt-tRNAGlu TTC (− 2.21-fold change). Meanwhile, the first 20 tRNA had higher expression levels in LSCC than in adjacent tissues and were all intracytoplasmic tRNA. In contrast, 18 of the first 20 tRNA with lower expression in LSCC tissues than in adjacent tissues were mitochondrial tRNA (Figs. 3 and 4).
Low expression of tRNAIniCAT in LSCC tissues
To validate the results of the PCR array, tumor and paracancerous tissue samples were collected from a total of 100 patients with LSCC through quantitative reverse-transcription PCR to determine the relative expression levels of tRNAIniCAT. However, as shown in Fig. 5, the expression levels of tRNAIniCAT in tumor tissues were significantly lower than those measured in adjacent paracancerous tissues (p = 0.0077). Among those, the expression levels of tRNAIniCAT in 63 LSCC tissues (63%) were lower than those recorded in the corresponding paracancerous tissues (Fig. 6).
tRNAIniCAT in plasma of patients with LSCC was downregulated
By exploring the relative expression levels of tRNAIniCAT in plasma, we obtained consistent results with those reported for tumor tissues. The expression levels of tRNAIniCAT in the preoperative plasma of patients with LSCC were significantly lower than those noted in postoperative plasma (p = 0.0032) and healthy human plasma (p < 0.0001). Meanwhile, the expression levels in postoperative plasma were significantly lower than those observed in healthy human plasma (p = 0.0458) (Fig. 7).
tRNAIniCAT expression levels and clinicopathological characteristics of patients with LSCC and potential diagnostic value
Tissues were divided into low and high expression groups according to the expression levels of tRNAIniCAT. Subsequently, we analyzed the relationship between the expression levels of tRNAIniCAT and clinicopathological factors. The results showed that the expression levels of tRNAIniCAT were not associated with clinicopathological features (Table 1). The area under the ROC curve for tRNAIniCAT in tissues and plasma was 0.575 and 0.808, respectively (Fig. 8).
|
Characteristics |
n (%) |
Low (%) |
High (%) |
P-value |
|---|---|---|---|---|
|
All cases |
86 (100) |
56 (65.1) |
30 (34.9) |
|
|
Age, years |
0.949 |
|||
|
≤ 60 |
34 (39.5) |
22 (39.3) |
12 (40) |
|
|
> 60 |
52 (60.5) |
34 (60.7) |
18 (60) |
|
|
Primary location |
0.851 |
|||
|
Supraglottic |
24 (27.9) |
16 (28.6) |
8 (26.7) |
|
|
Glottic |
62 (72.1) |
40 (71.4) |
22 (73.3) |
|
|
Differentiation |
0.732 |
|||
|
Well & moderate |
67 (77.9) |
43 (76.8) |
24 (80) |
|
|
Poor |
19 (22.1) |
13 (23.2) |
6 (20) |
|
|
Lymphatic metastasis |
0.571 |
|||
|
N0 |
75 (87.2) |
45 (85.7) |
27 (90) |
|
|
N1–N3 |
11 (12.8) |
8 (14.3) |
3 (10) |
|
|
Invasion |
0.949 |
|||
|
T1–T2 |
52 (60.5) |
34 (60.7) |
18 (60) |
|
|
T3–T4 |
34 (39.5) |
22 (39.3) |
12 (40) |
|
|
Clinical stage |
0.907 |
|||
|
I–II |
48 (55.8) |
31 (55.4) |
17 (56.7) |
|
|
III–IV |
38 (44.2) |
25 (44.6) |
13 (43.3) |
|
|
Smoking history |
0.701 |
|||
|
Yes |
55 (64) |
35 (62.5) |
20 (66.7) |
|
|
No |
31 (36) |
21 (37.5) |
10 (33.3) |
|
| Ct, cycle threshold; LSCC, laryngeal squamous cell carcinoma | ||||
High expression of tRNAIniCAT inhibits LSCC cell growth
AMC-HN-8 cells were transfected using LV3-tRNAIniCAT to upregulate tRNAIniCAT and negative control (LV3-NC) to assess the role of tRNAIniCAT in tumor progression. Following transfection of LV3-tRNAIniCAT and LV3-NC in AMC-HN-8 cells, green fluorescent protein fluorescence expression was observed (Fig. 9). The levels of tRNAIniCAT in the cells showed a 2.1-fold increase (Fig. 10). A cell inhibition rate analysis was performed to determine the effect of tRNAIniCAT on LSCC cell inhibition. The results showed that overexpression of tRNAIniCAT significantly inhibited cell growth compared with the NC group (Fig. 11).
Effects of tRNAIniCAT on cell cycle and apoptosis
For further exploration of the potential regulatory mechanisms of tRNAIniCAT in cell proliferation, cell cycle and apoptosis were assessed by flow cytometry. The upregulated tRNAIniCAT did not have a significant effect on the cell cycle (Fig. 12). Furthermore, the results of the apoptosis analysis showed that transfection of LV3-tRNAIniCAT significantly promoted apoptosis in AMC-HN-8 cells (Fig. 13). Collectively, these results indicated that tRNAIniCAT promoted apoptosis.
tRNAIniCAT inhibits growth of LSCC xenograft
We used an in vivo xenograft mouse model to investigate the role of tRNAIniCAT in inhibiting cancer. The mice were divided into three groups: LV3-tRNAIniCAT (high and low doses) and LV3-NC (Fig. 14). The results indicated that upregulation of tRNAIniCAT significantly inhibited tumor growth (Fig. 15). Among them, the weight of the transplanted tumor in the high dose group was significantly smaller than that in the NC group. During the experiment, there was no significant difference in tumor volume and mouse weight in these groups (Figs. 16 and 17). Pathological findings indicated that the administration of LV3-tRNAIniCAT significantly increased tissue necrosis in nude mice transplanted with tumors, showing a certain role of tRNAIniCAT in promoting apoptosis (Fig. 18). Through TEM, apoptotic cells were shown to have special structural characteristics. The autophagy and apoptosis of the tumor in the LV3-tRNAIniCAT treatment group were significantly increased, the phagocytic structure in the bubble was upgraded, and the nucleus had slightly shrunk (Fig. 19). Therefore, we concluded that tRNAIniCAT promotes LSCC cell apoptosis in vivo.
The expression spectrum of early LSCC mainly focused on mRNA and miRNA, such as DJ-1,12 HuR,13 and miR-34a,14 which were found to be associated with this disease. In the current study using gene chip technology, the expression profiles of tRNA in LSCC and normal tissues were found to differ. This study provides a complete expression profile of tRNA in LSCC.
tRNA was widely regarded as a housekeeping gene with limited regulatory function. There are only few tRNA with known additional functions,15 other than their usefulness as adapters for protein synthesis. In recent years, a growing body of evidence suggests that tRNA and its derivatives are dysregulated and participate in the pathogenic process of cancer.16 Mutations in tRNA and the involvement of co-oproteins produced by tRNA biogenesis and modification were found to be associated with cancer.17–19 Studies have found that tRNA synthesis was controlled by various oncogenic and tumor suppressor genes. Ras20 and c-Myc 21 facilitate RNA Pol III transcription; however, Rb22 and p5323 inhibit RNA Pol III transcription, leading to severe dysregulation of tRNA levels in multiple types of cancer. In addition, in several types of cancer, tRNA modified enzymes can add some tRNA modification, which changes their codon preferences and leads to an increase in protein expression levels of mRNA with "preference" codons.24, 25 Meanwhile, mutations in mitochondrial tRNA cause mitochondrial dysfunction which is also associated with tumorigenesis.26
Contrary to the profiling result, the present study confirmed the relative levels of tRNAIniCAT expression in 100 pairs of paired tissue samples, and revealed that tRNAIniCAT expression in LSCC tissues was downregulated (Fig. 5). tRNAIniCAT was downregulated in LSCC preoperative plasma compared with postoperative plasma; this finding was consistent with the results obtained in tissues (Fig. 7). Moreover, this study demonstrated that tRNAIniCAT may act as tumor inhibitor in LSCC in vitro and in vivo. Firstly, we used a LV3-tRNAIniCAT lentivirus to upregulate tRNAIniCAT in LSCC cells (Fig. 10). Cell inhibition rate analysis was conducted to determine the effect of tRNAIniCAT overexpression on cell proliferation. The data showed that overexpression of tRNAIniCAT inhibited cell growth (Fig. 11). Moreover, cell cycle and apoptosis were evaluated to further investigate the biological functions of tRNAIniCAT in LSCC cells. The results showed that the upregulation of tRNAIniCAT did not significantly affect the cell cycle (Fig. 12). However, overexpression of tRNAIniCAT improved the rate of apoptosis in treated AMC-HN-8 cells (Fig. 13). Lastly, we reached the same conclusion based on experiments in BALB/c mouse xenografts; tRNAIniCAT inhibited tumor growth and promoted tumor cell apoptosis in vivo. Overexpression of tRNAIniCAT significantly decreased the tumor weight of the xenografts (Fig. 15). By pathological examination and TEM, we found that overexpression of tRNAIniCAT significantly increased tumor cell apoptosis and autophagy (Figs. 18 and 19).
The findings of this study are consistent with those of previous studies. Numerous studies have confirmed the important role of tRNA in regulating gene expression. Change in bacterial activity tRNA content plays an adaptive role with environmental signal changes.27 The binding of tRNA to cytochrome C inhibits the effects of cytochrome C and apoptotic proteases, thereby inhibiting apoptosis and enzyme activity .28 Overexpression of the initial tRNA (tRNAiMet) was observed in normal mammary epithelial cells. Changes in the whole cell tRNA expression levels accelerate the speed of cell proliferation.29 In carcinoma-associated fibroblasts, tRNAiMet promotes tumor proliferation and angiogenesis.30 Studies revealed that tRNAIle expression was higher in breast cancer-associated fibroblasts than in normal fibroblasts .30,31 These abnormally expressed tRNA molecules are expected to be new prognostic markers for such diseases.32 tRNAGluUUC and tRNAArgCCG are highly expressed in breast cancer and enhance tumor invasion. EXOSC2 and GRIPAP1 are downstream target proteins of tRNAGluUUC to promote the progression of cancer invasion and metastasis.33 In human epidermal growth factor receptor 2-positive breast cancer cell lines, free tRNALeu may interact with human epidermal growth factor receptor 3 (ErbB3) and binding protein (EBP1), which in turn activates the ErbB2/ErbB3 signaling pathways, and ultimately promotes cancer cell proliferation.34 tRNA plays a key role in translation, and its dysregulation may affect cell protein expression. Cancer cells regulate the expression of multiple promoters of cancer progression by regulating the levels of tRNA. This leads to the notion that cancer cells exhibit tRNA regulatory effects in addition to the numerous known regulatory mechanisms that alter the expression of cancer progression promoters. Disorders of tRNAIniCAT we found in LSCC may cause dysregulation of downstream target protein expression, which in turn changes the ability of tumor proliferation and apoptosis.
The present study provides a comprehensive tRNA expression spectrum for LSCC. The novel tRNAIniCAT can inhibit the proliferation of LSCC cells and promote apoptosis in vitro and in vivo. Studies show that tRNAIniCAT may be a diagnostic biomarker and a potential therapeutic target in LSCC.
LSCC, laryngeal squamous cell carcinoma; qRT-PCR, quantitative real-time polymerase chain reaction; tRNA,transfer RNA; TEM,transmission electron microscopy; ROC,Receiver operating characteristic curve.
Ethics approval and consent to participate
This study was approved by the Ethics Committee of Human Research of Ningbo University,Ningbo, Zhejiang, China.This study was approved by the Animal Ethical Care and Use Committee of Zhejiang University of Traditional Chinese Medicine,Hangzhou, Zhejiang, China.
Availability of data and material
The datasets used and analyzed during the current study are available from the corresponding author upon request.
Funding
This work was supported by grants from Ningbo Health Branding Subject Fund (PPXK2018-02), the Natural Science Foundation of Zhejiang(Grant No. LY20H130001),the Natural Science Foundation of Ningbo (Grant Nos. 2017A610236; 2018A610361;2019A610319),
the Leading and Top Talents Training Projects of Ningbo (NBLJ201801032), and the Medical and Health Training Project of Zhejiang Province (Grant Nos. 2015RCB025; 2018RC063).
Competing interests
The authors report no conflicts of interest in this work.
Authors' contributions
All authors contributed to data analysis, drafting or revising the article, gave final approval of the version to be published, and agree to be accountable for all aspects of the work.
Consent for publication
Authors involved in this paper all signed written consent for publishing
Acknowledgements
We thank all those who participated in this study
- Ribeiro El-Achkar VN, Duarte A, Pinto Saggioro F, De Mello Filho FV, León JE, Ribeiro-Silva A, Kaminagakura E: Squamous Cell Carcinoma Originating from Adult Laryngeal Papillomatosis: Case Report and Review of the Literature. Case reports in otolaryngology 2018, 2018:4362162.
- Fusconi M, Campo F, Gallo A, Zambetti G, Martellucci S, Seccia A, de Vincentiis M: Laryngeal Cancer, HPV DNA vs E6/E7 mRNA Test: A Systematic Review. Journal of voice : official journal of the Voice Foundation 2017, 31(2):248.e241-248.e245.
- Shen Y, Yu X, Zhu L, Li T, Yan Z, Guo J: Transfer RNA-derived fragments and tRNA halves: biogenesis, biological functions and their roles in diseases. Journal of molecular medicine (Berlin, Germany) 2018, 96(11):1167-1176.
- Giegé R: Toward a more complete view of tRNA biology. Nature structural & molecular biology 2008, 15(10):1007-1014.
- Rodnina MV, Wintermeyer W: The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation. Biochemical Society transactions 2011, 39(2):658-662.
- Boccaletto P, Machnicka MA, Purta E, Piatkowski P, Baginski B, Wirecki TK, de Crécy-Lagard V, Ross R, Limbach PA, Kotter A et al: MODOMICS: a database of RNA modification pathways. 2017 update. Nucleic acids research 2018, 46(D1):D303-d307.
- Oerum S, Dégut C, Barraud P, Tisné C: m1A Post-Transcriptional Modification in tRNAs. Biomolecules 2017, 7(1).
- Pavon-Eternod M, Gomes S, Geslain R, Dai Q, Rosner MR, Pan T: tRNA over-expression in breast cancer and functional consequences. Nucleic acids research 2009, 37(21):7268-7280.
- Huang SQ, Sun B, Xiong ZP, Shu Y, Zhou HH, Zhang W, Xiong J, Li Q: The dysregulation of tRNAs and tRNA derivatives in cancer. Journal of experimental & clinical cancer research : CR 2018, 37(1):101.
- Tuorto F, Parlato R: rRNA and tRNA Bridges to Neuronal Homeostasis in Health and Disease. Journal of molecular biology 2019, 431(9):1763-1779.
- Zhou Z, Sun B, Huang S, Jia W, Yu D: The tRNA-associated dysregulation in diabetes mellitus. Metabolism: clinical and experimental 2019, 94:9-17.
- Shen Z, Jiang Z, Ye D, Xiao B, Zhang X, Guo J: Growth inhibitory effects of DJ-1-small interfering RNA on laryngeal carcinoma Hep-2 cells. Medical oncology (Northwood, London, England) 2011, 28(2):601-607.
- Shen Z, Ye D, Zhang X, Jiang Z, Xiao B, Guo J: Inhibitory effect of HuR gene small interfering RNA segment on laryngeal carcinoma Hep-2 cell growth. The Journal of laryngology and otology 2010, 124(11):1183-1189.
- Shen Z, Zhan G, Ye D, Ren Y, Cheng L, Wu Z, Guo J: MicroRNA-34a affects the occurrence of laryngeal squamous cell carcinoma by targeting the antiapoptotic gene survivin. Medical oncology (Northwood, London, England) 2012, 29(4):2473-2480.
- Grewal SS: Why should cancer biologists care about tRNAs? tRNA synthesis, mRNA translation and the control of growth. Biochimica et biophysica acta 2015, 1849(7):898-907.
- Anderson P, Ivanov P: tRNA fragments in human health and disease. FEBS letters 2014, 588(23):4297-4304.
- Blanco S, Frye M: Role of RNA methyltransferases in tissue renewal and pathology. Current opinion in cell biology 2014, 31:1-7.
- Suzuki T, Nagao A, Suzuki T: Human mitochondrial tRNAs: biogenesis, function, structural aspects, and diseases. Annual review of genetics 2011, 45:299-329.
- Yao P, Fox PL: Aminoacyl-tRNA synthetases in medicine and disease. EMBO molecular medicine 2013, 5(3):332-343.
- Wang HD, Trivedi A, Johnson DL: Hepatitis B virus X protein induces RNA polymerase III-dependent gene transcription and increases cellular TATA-binding protein by activating the Ras signaling pathway. Molecular and cellular biology 1997, 17(12):6838-6846.
- Gomez-Roman N, Grandori C, Eisenman RN, White RJ: Direct activation of RNA polymerase III transcription by c-Myc. Nature 2003, 421(6920):290-294.
- White RJ, Trouche D, Martin K, Jackson SP, Kouzarides T: Repression of RNA polymerase III transcription by the retinoblastoma protein. Nature 1996, 382(6586):88-90.
- Crighton D, Woiwode A, Zhang C, Mandavia N, Morton JP, Warnock LJ, Milner J, White RJ, Johnson DL: p53 represses RNA polymerase III transcription by targeting TBP and inhibiting promoter occupancy by TFIIIB. The EMBO journal 2003, 22(11):2810-2820.
- Novoa EM, Pavon-Eternod M, Pan T, Ribas de Pouplana L: A role for tRNA modifications in genome structure and codon usage. Cell 2012, 149(1):202-213.
- Novoa EM, Ribas de Pouplana L: Speeding with control: codon usage, tRNAs, and ribosomes. Trends in genetics : TIG 2012, 28(11):574-581.
- Florentz C, Sohm B, Tryoen-Tóth P, Pütz J, Sissler M: Human mitochondrial tRNAs in health and disease. Cellular and molecular life sciences : CMLS 2003, 60(7):1356-1375.
- Subramaniam AR, Pan T, Cluzel P: Environmental perturbations lift the degeneracy of the genetic code to regulate protein levels in bacteria. Proceedings of the National Academy of Sciences of the United States of America 2013, 110(6):2419-2424.
- Mei Y, Yong J, Liu H, Shi Y, Meinkoth J, Dreyfuss G, Yang X: tRNA binds to cytochrome c and inhibits caspase activation. Molecular cell 2010, 37(5):668-678.
- Pavon-Eternod M, Gomes S, Rosner MR, Pan T: Overexpression of initiator methionine tRNA leads to global reprogramming of tRNA expression and increased proliferation in human epithelial cells. RNA (New York, NY) 2013, 19(4):461-466.
- Clarke CJ, Berg TJ, Birch J, Ennis D, Mitchell L, Cloix C, Campbell A, Sumpton D, Nixon C, Campbell K et al: The Initiator Methionine tRNA Drives Secretion of Type II Collagen from Stromal Fibroblasts to Promote Tumor Growth and Angiogenesis. Current biology : CB 2016, 26(6):755-765.
- Kojima Y, Acar A, Eaton EN, Mellody KT, Scheel C, Ben-Porath I, Onder TT, Wang ZC, Richardson AL, Weinberg RA et al: Autocrine TGF-beta and stromal cell-derived factor-1 (SDF-1) signaling drives the evolution of tumor-promoting mammary stromal myofibroblasts. Proceedings of the National Academy of Sciences of the United States of America 2010, 107(46):20009-20014.
- Krishnan P, Ghosh S, Wang B, Heyns M, Li D, Mackey JR, Kovalchuk O, Damaraju S: Genome-wide profiling of transfer RNAs and their role as novel prognostic markers for breast cancer. Scientific reports 2016, 6:32843.
- Goodarzi H, Nguyen HCB, Zhang S, Dill BD, Molina H, Tavazoie SF: Modulated Expression of Specific tRNAs Drives Gene Expression and Cancer Progression. Cell 2016, 165(6):1416-1427.
- Kwon NH, Lee MR, Kong J, Park SK, Hwang BJ, Kim BG, Lee ES, Moon HG, Kim S: Transfer-RNA-mediated enhancement of ribosomal proteins S6 kinases signaling for cell proliferation. RNA biology 2018, 15(4-5):635-648.