Parasite samples
Twelve L. (V.) braziliensis clinical isolates were acquired from the biological collection of the Evandro Chagas National Institute of Infectious Diseases at Fundação Oswaldo Cruz (INI – Fiocruz). All parasites were isolated before Glucantime® treatment from five patients who were classified as responders (R) because they presented complete lesion healing and clinical cure; and seven non-responders (NR) who had therapeutic failure or relapse. The medical personal of the Leishmaniasis Clinical Research and Vigilance Laboratory (LaPClinVigiLeish) at INI – Fiocruz were responsible for this classification following the criteria reported for ATL patient’s treatment in the state of Rio de Janeiro – Brazil [4,33,34].
For this study, each isolate was named after its patient response: Responder (R1, R2, R3, R4, R5) and Non-responder (NR1, NR2, NR3, NR4, NR5, NR6, NR7).
Parasites culture and in vitro differentiation
Parasites were defrosted and initially cultured in biphasic Novy-MacNeal-Nicolle (NNN) medium, containing 10% of inactivated FBS. Then, they were expanded in Schneider´s insect medium at pH 7.2 supplemented with 20% of inactivated FBS, 200 International Units (IU) penicillin and 200 mg/mL streptomycin and maintained at 26 °C. To obtain each isolate growth curve, 3x105 promastigotes were initially cultured and maintained in 25 cm2 flasks containing the medium described above. Daily, for eight days, a 10 mL aliquot was taken to determine the number of viable parasites using a Neubauer chamber. Each parasite isolate did not have more than 5 passages since isolation. Differentiation from promastigotes to axenic amastigotes was performed as previously described by Cysne-Finkelstein et al. [20], with some modifications. Briefly, 5x105 per mL of log-phase promastigotes were cultured in Schneider medium (pH 5.5) supplemented with 20% of FBS, 60 IU penicillin, 60 mg/mL streptomycin and maintained at 26 °C for 2 days. Then, to complete differentiation, each culture was subjected to temperature shock (32 °C) for 2 days.
In vitro susceptibility assays
Log-phase promastigotes and axenic amastigotes forms, of each isolate, were tested against Glucantime®or SbV and antimony potassium tartrate or SbIII (Sigma Aldrich Chemical Co., St. Louis, MO, USA) to measure the half-maximal inhibitory concentration (IC50) induced by these drugs. The IC50 was determined by AlamarBlue™ reduction assay as previously described (Shimony and Jaffe, 2008), with some modifications. Briefly, each parasite form was seeded in 96-well plates in triplicate at adequate conditions: log-phase promastigotes (4x106 parasites/mL) and one-day axenic amastigotes (5x105 parasites/mL) in 100 µL of Schneider medium (pH 7.2 or pH 5.5, respectively) supplemented with 20% of FBS and each drug in decreasing concentrations, leaving one column without any drug to serve as control. For SbV ranging from 20 mg/mL to 6x10-4 mg/mL; for SbIII ranging from 0.196 mg/mL to 5x10-6 mg/mL, with a 2:1 dilution factor between each concentration. Parasites cultures were incubated (26 °C, 48 h and 32 °C, 24 h), respectively. After each incubation time, 10 mL of AlamarBlue™ was added to each well, the plates were then re-incubated at their respective temperatures for 4 hours. Then, each plate was read on a Spectramax 190 microplate spectrophotometer (Molecular Devices Corporation) at 570 excitation and 590 nm emission wavelengths, and the percentage of reduction of AlamarBlue™ was determined.
Protein extraction
Log-phase promastigotes (108 to 109 parasites/mL) and one-day axenic amastigotes (108 parasites/mL) were separately used to obtain whole protein extracts as it follows. Parasites were washed by centrifugation (3 000 × g, 4 °C, 10 min) in sterile cold PBS pH 7.2. Then, the pellets were re-suspended in 1 mL of lysis buffer (100 mM Tris-HCl pH 8.0, 150 mM NaCl, 10% glycerol and 0.6% Triton X-100) and subjected to a minimum of 5 freeze-thaw cycles. After complete parasites lysis, the soluble fraction was obtained by centrifugation (25 000 x g, 30 min, 4 °C) and the supernatant stored at -80 °C until further use. Whole-protein concentrations were determined by the Lowry method using BSA as a standard protein, as described elsewhere [36].
Enzymatic assays
The serine protease activity of the whole protein extract (5 µg of total protein) was assessed in activation buffer (10 mM Tris-HCl pH 7.5) using a specific fluorogenic peptide substrate (Z-FR-AMC at 1 mM) at a final volume of 60 mL. Samples were incubated (60 min, 37 °C), and the variance in the relative fluorescence was monitored on a Molecular Devices SpectraMax spectrophotometer (Gemini XPS). Inhibition assays were performed by incubation (5 min, 25 °C) of the samples with E-64 [10 mM], PMSF [1 mM], AEBSF [1 mM] and TLCK [100 mM] (Sigma Aldrich Chemical Co., St. Louis, MO, USA); which are the maximum concentrations recommended for each specific inhibitor. The substrate cleavage rate was defined as follows: v = Ds/Dt, where v = velocity, Ds = substrate concentration variation and Dt = total reaction time. The self-degradation of the fluorescent peptide substrate was controlled throughout the assay to avoid incorrect readings. The enzymatic activity is expressed as mmol min-1.mg of protein-1.
Primers design
The primers used in this study were previously designed and used to detect serine proteases and tryparedoxin peroxidase transcripts [38]. Briefly, the design is based on the L. (V.) braziliensis subtilisins (LbrM.13.0860: sense-5′ ATCTGGCGATTTCTCCCTTT 3′ and antisense-5′ GAGCTAACACCAG 3′; LbrM.28.2570: sense-5′ CACTGCGCTCCACATACACT 3′ and antisense-5′ GCCTTCATTCGAGCTACAGG 3′) and tryparedoxin peroxidase (LbrM.15.1080: sense-5′ CTCTGTGGACAGCGAGTACG 3′ and antisense-5′ TGGGGTCGATGATAAAGAGG 3′) sequences recorded in the Genedb database (http://www.genedb.org). All the primers were synthesized by Invitrogen Brazil at a concentration of 50 nM and purified by desalting.
RNA extraction and cDNA synthesis
Log-phase promastigotes (108 to 109 parasites/mL) and one-day axenic amastigotes (107 parasites/mL) were separately lysed in 1mL TRIzol containing 200 mL of chloroform. RNA extraction was performed using the RNeasy Mini Kit (Qiagen, Hilden, Germany). according to the manufacturer’s instructions and some modifications. The samples were centrifuged (10 000 × g, 10 min, 4 °C). The supernatants containing RNA were dissolved with Isopropanol (12 000 × g, 20 min, 4 °C) and washed with 70% ethanol (9 000 × g, 5 min, 4 °C). Then, each pellet was re-suspended in 30 to 40 mL of DEPC-treated water and incubated (10 min, 56 °C) to complete dissolution. The RNA concentrations were measured by spectrophotometry at 260/280 nm and 230/260 nm. cDNA synthesis was performed using the SuperScript® III Kit (Invitrogen Life Technologies, Carlsbad, USA) using maximum 4 µg of total RNA.
RT-PCR
Primers complementary to the LbrM.13.0860, LbrM.28.2570, LbrM.15.1080 genes were used for Reverse Transcriptional-Polymerase Chain Reaction (RT-PCR) under the following reaction conditions: 10X PCR Buffer, 50 mM MgCl2, 10 mM of each dNTP, 0.3 µM of each primer and 1 U Platinum™ Taq DNA polymerase (Invitrogen Life Technologies, Carlsbad, USA), together with 20 ng of cDNA, adjusted to a final volume of 25 μL. The amplification cycles were: initial denaturation (94 °C, 3 min), 40 cycles of denaturation, hybridization and extension (95 °C, 20 s; 56 °C, 30 s; 72 °C, 30 s) and a final extension step (72 °C, 5 min) using a PTC-100 Thermal Cycler (Applied Biosystems, Foster City, CA, USA). The amplified products were evaluated by 1.2% (w/v) agarose gel electrophoresis and stained with ethidium bromide.
Statistical analysis
GraphPad Prism software (version 8.3.0) was used to calculate IC50 values and perform Student’s T test, considering p <0.05 as significant. To compare the inhibition regimens (W/i, E-64, PMSF, AEBSF, TLCK) in each isolate, we used 2way ANOVA followed by Dunnett’s multiple comparison test.
Additionally, the quantitative variables obtained for each clinical isolate: i) promastigotes SbV IC50, (ii) promastigotes SbIII IC50 and (iii) axenic amastigotes, (iv) Z-FR-AMC protease activity substrate over promastigotes and (v) axenic amastigotes, (vi) PMSF inhibition over promastigotes and (vii) axenic amastigotes, (viii) AEBSF inhibition over promastigotes and (ix) axenic amastigotes, (x) TLCK inhibition over promastigotes and (xi) axenic amastigotes were normalized and subjected to principal component analysis (PCA). The first three PCs (PC1, PC2, PC3) were used to cluster the clinical isolates using the K-means algorithm clustering method. The total-within cluster sum of squares (twcss) (Equation 1), as a function of the number of clusters, was analysed to determine the optimal number of clusters; where the squared distances between each cluster centroid
and each of its cluster members
are summed over each cluster c_i, Nc being the total number of clusters. Additionally, with the previously normalized data we explored the clusters characteristics by calculating the pairwise distance between clusters using the normalized values of SbIII IC50, PMSF, AEBSF and TLCK inhibition over promastigotes and axenic amastigotes. The statistical analysis was carried out using R (version 1.1.463).
![](https://myfiles.space/user_files/58892_7798ecd9a40b82f9/58892_custom_files/img1600866022.png)