2.1 Cell culture
Human ESCC cell lines EC9706 and EC109 and ECA109 were maintained in our lab (Xian, China). het-1A, a human immortal esophageal squamous epithelial cell line, was donated by Zhengzhou University (Zhengzhou, China). ESCC cells and het-1A were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, Thermo Fisher Scientific, Cambridge, MA, USA) supplemented with 10% fetal bovine serum (Evergreen; Hangzhou, China), 100 µg/ml of streptomycin, and 100 U/ml of penicillin in the medium (HyClone; Logan, Utah, USA). All cells were cultured in a humid incubator at 37℃ with 5% CO2.
2.2 Total RNA extraction and qRT-PCR
We implemented total RNA isolation and extraction from the tissue samples and cell lines using Trizol reagent (Invitrogen, Waltham, MA, United States). cDNA was obtained by reverse transcription of the RNA using the PrimeScript RT Reagent Kit (TaKaRa, Tokyo, Japan). qRT-PCR was subsequently performed to examine the expression levels of HMGB3 and TGIF2 by the SYBR Premix Ex Taq II Kit (TaKaRa, Tokyo, Japan). GAPDH was used as an internal standard. The 2-△△Ct method was used to calculate the relative mRNA expression. The primer sequences were listed below. HMGB3 forward: 5′-CCATGATTCCTTCATATTTGC-3′; reverse: 5′-GTAATACGGTTATCCACGCG-3′; TGIF2 forward: 5′- TACTTGCACCGCTACAACGC -3′; reverse: 5′- TCCTTCCGAAGCATGTCTGG -3′; GAPDH forward: 5′-GACAGTCAGCCGCATCTTCT-3′; reverse: 5′-GCGCCCAATACGACCAAATC-3′.
2.3 Western blot (WB) assay
The cells were lysed using radioimmunoprecipitation assay (RIPA) buffer (Beyotime Biotechnology, Shanghai, China) added with protease repressors (Millipore, Temecula, CA, USA) on ice. Then, the cell lysates were centrifuged at 12,000 g for 15 min. A BCA Protein Assay Kit (Pierce, Rockford, IL, United States) was used to detect the concentration of total proteins. Equal volumes of proteins were separated, employing 10% sodium dodecyl sulfate-poly acrylamide gel electrophoresis (SDS-PAGE). Then, they were transferred onto nitrocellulose membranes (Millipore, Temecula, CA, USA). Subsequently, membranes were blocked with 5% non-fat milk for one hour at 37℃ and then incubated with antibodies overnight at 4°C. After that, the membranes were incubated with horseradish peroxidase (HRP)-labeled secondary anti-mouse IgG or anti-rabbit IgG antibodies (Abcam,Cambridge, MA, USA) for one hour at 37℃. The following primary antibodies were applied to exam the proteins expression: anti-HMGB3 (#ab75782, Abcam, Cambridge, MA, USA), anti-TGIF2 (#ab190152, Abcam,Cambridge, MA, USA), anti-SMAD2 (#5339, Cell Signaling Technology, Cambridge, MA, USA), anti-p-SMAD2 (#3108, Cell Signaling Technology, Beverly, MA, USA), anti-SMAD3 (#9523, Cell Signaling Technology, Beverly, MA, USA), anti-p-SMAD3 (#9520, Cell Signaling Technology, Beverly, MA, USA), anti-SMAD2/3 (#8685, Cell Signaling Technology, Beverly, MA, USA), anti-TLR3 (#ab62566, Abcam, Cambridge, MA, USA), anti-TGF-β (#ab215715, Abcam, Cambridge, MA, USA) and anti-β-actin (#3700, Cell Signaling Technology, Beverly, MA, USA). Protein bands visualization was implemented on an enhanced chemiluminescence detection system (Bio-Rad, CA, USA) and analyzed by image J software.
2.4 Plasmid construction and chromatin immunoprecipitation assay
5′-flanking deletion and site-directed mutation were constructed. The sequence from -2000bp to 500 around the promoter site of human HMGB3 was cloned into the pGL3-Basic vector (Promega). The HMGB3 promoter construct (-2000/500) was used as a template to generate 5′-flanking deletion constructs of the HMGB3 promoter. We validated the promoter fragments by DNA sequencing.
Magna ChIP G assay kit (Millipore, Temecula, CA, USA) was employed for ChIP assay performance. Briefly speaking, utilizing 1% formaldehyde, indicated cell lines were crosslinked at 37 °C for 10 min, followed by glycine quenching. The bound DNA was subsequently obtained from the sonicated cell lysates. The bound DNA was thereafter coimmunoprecipitated with primary antibodies against TGIF2 (Santa cruz, sc-390870, CA, USA) and normal IgG (Cell Signaling Technology, Danvers, MA, USA). Then the corresponding binding sites of the promoters was amplified after subjected to PCR.
2.5 Cell transfection and infection
Negative control lentiviral vectors and lentiviral vectors for upregulating or downregulating the target genes were designed and provided by Genechem Co. Ltd. (Shanghai, China). Sequences for the shRNAs were as follows: shHMGB3-1 (93473-1), CCGGCAGATAAAGTGCGCTATGACTCGAGTCATAGCGCACTTTATCTGTTTTTG; shHMGB3-2 (93474-1), CCGGGAGGCAAGAAGAAGAAGGACTCGAGTCCTTCTTCTTCTTGCCTCTTTTTG; shTGIF2-1(94886-1), CCGGCCATCCCTTTAGTCTCTGAAACTCGAGTTTCAGAGACTAAAGGGATGGTTTTT. shTGIF2-2(94887-1), CCGGGACCCTAATCAGTTTACCATTCTCGAGAATGGTAAACTGATTAGGGTCTTTTT.
ESCC cells were infected with the MOI set as 40. The cells were then selected using 1-4 ug/ml puromycin for 14 days.
2.6 CCK-8 assay
1× 103 cells in 100μl were seeded into 96-well plates per well. We replaced the original medium with CCK-8 solution (TransDetect Cell Counting Kit, Transgene, Beijing, China) with complete medium mixing at a 1:9 ratio at the same time in 5 days. We subsequently incubated cells at 37 °C for three hours. Each sample was inspected at 450 nm, and a microplate reader (Bio-Rad, CA, USA)was used to obtain the absorbance.
2.7 In vitro migration and invasion assays
In vitro migration and invasion abilities of infected cell lines were measured using 24-well Transwells (8μm pore size, Corning, Inc., NY, USA). In the migration experiment, 4 × 105 cells were seeded in the top chamber. While in the invasion experiment, every top chamber was coated with 200 mg/ml Matrigel and dried for one hour at 37 ℃. Then, 8 × 105 cells were plated in the chamber, and the invading and migrating cells at the lower layer were counted 36 h later.
2.8 Colony formation assay
The ESCC cells suspension (800 cells) was seeded in 6-well plates. They were then cultured for two weeks in a 5% CO2 incubator at 37◦C. Subsequently, the cells were fixed with 10% formalin for 15 min, after which they were stained via 0.1% crystal violet for 15 min.
2.9 Cell cycle assay
The seeded stable infected ESCC cells attaining the log phase via trypsinization were harvested to 1ml centrifuge tube. Subsequently, we rinsed cells in a phosphate-buffered saline (PBS) buffer. We then fixed the samples in 75% ethanol for 1 hour at -20℃. Fixed cells were rinsed again by PBS, followed by 400ul propidium iodide (Servicebio,) staining within 100ul RNase at 37℃ for 30 minutes in the dark. We finally implemented cell cycle analysis by the flow cytometer (CytoFLEX, Beckman Coulter, Brea, CA, United States).
2.10 Xenograft experiment and in vivo metastasis experiment
Balb/c mice (6 weeks old) were obtained from Shanghai Experimental Animal Center of the Chinese Academy of Sciences (Shanghai, China). The mice were raised in specific pathogen-free conditions in the Animal Research and Care Committee of the Fourth Force Military Medical University. We randomly assigned these mice into experimental or control groups. We created the xenograft tumor models via subcutaneous injection of 5 × 106 indicated cells. We measured the tumor size every three days, and calculated the volume using the following formula: volume = (length × width2)/2. Mice were sacrificed when the volume of the largest tumor in the group is close to 1000 . We conducted tail vein injection assays in BALB/C nude mice (5 weeks old) via 4 × 106 indicated cells. Mice were sacrificed after 6 weeks when they were in poor condition, and the lungs and livers were extracted for histological staining and examination. The survival time of mice was also recorded. The use of live animals in this research was approved by the Committee inTeaching and Research (CULATR) at Fourth Military Medical University.
2.11 Immunohistochemistry
The human ESCC tissue microarray (TMA) (Lot No. HEsoS180Su08) was purchased from Shanghai Outdo Biotech Co., LTD (Shanghai, China). It contained 114 ESCC and 66 para-tumor tissues. These tissues were obtained from patients who underwent radical esophagectomy from April 2006 to December 2008. This research was ratified by the ethics committee of Xijing Hospital, Fourth Military Medical University. Xylene and then graded alcohol were utilized to deparaffinize the TMA slides. The endogenous peroxidase activity was blocked using 3% H2O2, and 10% goat plasma was used to block the slices. Thereafter, overnight anti- HMGB3 antibody (1:800, Abcam, Cambridge, MA, United States), anti- TGIF2 antibody (1:500, Abcam, Cambridge, MA, United States) incubation was performed. Following conjugation with biotinylated secondary antibody and then HRP, DAB staining and subsequently hematoxylin counterstaining was applied. The images were obtained on a fluorescence microscope (3DHISTECH, Sysmex, Switzerland).
Pathologists were invited to view the TMA utilizing the histochemical score (H-score) to assess the staining intensity and the percentage of stained cells. The staining intensity was scored on a range of 0 to 3: 0 (no staining), 1 (weakly staining), 2 (moderate staining), and 3 (strong staining). The percentage of stained cells was scored as follows: 0 (no staining, 0%), 1 (staining range, 1–25%), 2 (staining range, 26–50%), 3 (staining range, 51–75%), or 4 (staining range, 76–100%). The final H-score was calculated by multiplying values of staining intensity and percentage of stained cells. H-score was used to classify low or high expression.
2.12 Co-IP assay
EC9706 and ECA109 were lysed in the non-denaturing lysis buffer in Abcam Immunoprecipitation Kit (ab206996) to get total proteins. 500μg Proteins were coimmunoprecipitated with 5 ug primary antibodies (TLR3, Novus Biologicals, NBP-24875; HMGB3, Abcam, ab75782) or IgG (Beyotime Biotechnology, Shanghai, China), and protein A/G Sepharose in the Abcam Immunoprecipitation Kit overnight at 4 ℃. Subsequently, the sepharose was washed for three times by wash buffer. The samples were finally boiled adding 1/4 loading buffer (Beyotime Biotechnology, Shanghai, China) before subjected to WB.
2.13 Statistical analysis
IBM SPSS Statistics 22.0 software was used to implement all the statistical computations. The Student’s t-test was used to analyze the correlation between HMGB3 or TGIF2 expression in ESCC and para-tumor tissues. The link between the HMGB3 or TGIF2 expression and the clinicopathological parameters of ESCC patients was calculated using the Chi-square test. The Kaplan-Meier approach was then utilized to draw the survival curve of patients with different expressions of HMGB3, TGIF2, and their combinations. We performed a log-rank assessment to inspect the connection between HMGB3, TGIF2 expression and the prognosis of ESCC. two-tailed Student t-test was employed to inspect differences between variables in the variable groups. p<0.05 was set as significantly different.