A 34-year old woman was diagnosed at early childhood with a primary immunodeficiency presenting with autoimmune hemolytic anemia (AIHA), hypogammaglobulinemia, lymphadenopathy, recurrent upper respiratory infections and meningitis. After splenectomy for AIHA, she continuously received intravenous immunoglobulin substitution, during which infections were relatively infrequent. At the age of 13 years flowcytometry revealed an increased fraction of CD4/CD8 double negative T-cells (DNT), comprising between 30–50% of the TCRab CD3 positive T-cells. Based on these findings a defect in FAS induced apoptosis was suspected. At the age of 14 a missense Ile243-Arg FAS mutation (laboratory of Rieux-Laucat, Paris) was verified in peripheral blood cells. Based on these findings and reduced mutated fraction of somatic hypermutation of expressed immunoglobulin kappa light chain (examined by restriction enzyme based hot-spot mutation assay (IgκREHMA)) in B-cell, a definitive diagnosis of ALPS-FAS with CVID was made (7).
During her lifetime she had persistent moderate neutropenia and normal serum B12 levels. T-cell lymphocytosis, up to 18 mia/L CD3 positive T-cells consisted of up to 60% DNT, was detected regularly up to the age of 18 (2002) but at the age of 26 (2010) a significant decrease of T-cell lymphocytosis and DNT fraction was observed.
At age of 27 years, she was treated for recurrent genital HPV condylomata. Two years later, progressive extensive bluish nodular skin lesions developed Fig. 1. Cutaneous lymphoma was suspected, but skin biopsies demonstrated a polyclonal T-cell lymphoproliferation and lymph node biopsy and PET-CT were without lymphoma. Treatment with alitretinoin followed by 6 months of peg-interferon had no effect on the skin lesions.
Early 2017, at age 34, she developed slowly progressive gait disturbance and vertigo, which during the next 6 months progressed to severe truncal ataxia, dyskinesia and nystagmus. Cognition was normal. Severe cerebellar vermis atrophy was found on MRI. Figure 2, A and B. CSF was acellular with normal protein. Extensive investigations for infectious, autoimmune and paraneoplastic conditions were done on CSF and blood including gastrointestinal biopsies and whole-body PET-CT, which were all negative. High dose high dose iv methylprednisolone was given on suspicion of an auto-inflammatory aetiology but stopped when CSF was found positive for JCV DNA. A diagnosis of JCV-GCN was made.
Treatment
IVIG treatment doses were increased to keep IgG at a minimum level of 12 g/l. Mirtazepin, which she already received for depression, was continued.
Cidofovir treatment was initially given 7 times for three months (September to November 2017), during which cerebellar symptoms and MRI changes were stable and CSF-JCV levels decreased moderately- Fig. 3. Three months later, however, progression was suspected because of slight worsening in ataxia and rising JCV-CSF levels, at which time cidofovir treatment was repeated once, but was terminated because of uveitis, possibly related to cidofovir(8) .
Fusidic acid, commonly used in Denmark for treatment of staphylococcal infections, has possible in vitro efficacy against JCV with a single case report describing effect against JCV associated nephropathy(9,10). In standard dosage, fusidic acid has relative low CSF penetration, but better into brain tissue(11–13). Since progression of ataxia was suspected and CSF-JCV-levels remained (Fig. 2), treatment with high dose fusidic acid (1500 mg x 2) was attempted. After 1 month at which a relatively high level of CSF-fucidic acid (2.5 mg/L) was measured JCV-CFS levels had decreased to 71 from 478 copies/ml. Because of gastrointestinal side-effects, the dosage was then reduced to 500 mg x 3 after which CSF-fucidic acid levels decreased to 0.4 mg/L, after which time treatment was stopped, Fig. 3. During the next 7 months, the ataxia, MRI and skin changes remained unchanged. JCV was detected twice in blood.
However, over a 2-week period in November 2018, she suddenly developed progressive severe blindness and reduced lower leg power. On MRI non-enhancing parietal PML lesions was found bilaterally- Fig. 2. PML is associated with increased programmed cell death-1 (PD-1) expression, a marker of cellular immune exhaustion with increased JCV-specific T-cell immune responses following PD-1 inhibition(14). At the change from JCV-GCN to progressive PML, increased PD-1 expression on T-cells was demonstrated. Based on these observations and a case report showing benefit of PD1- inhibition in BK-encephalitis (Holland SM, oral presentation, ESID, Barcelona 2016, unpublished. Subsequent reports of PD-1 inhibitor treatment of PML had not been published), we decided to administer the PD-1 inhibitor pembrolizumab.
However, 5 days after pembrolizumab infusion she developed severe encephalopathy with confusion and a central fascial paresis. Although no definitive signs of IRIS could be demonstrated on MRI, PD-1 inhibitor associated immune reconstitution inflammatory syndrome (IRIS) encephalitis was suspected, and methylprednisolone was administered, with only limited effect. PML progressed rapidly and she died 14 days after the pembrolizumab infusion.
Immunology
At the diagnosis of JCV-GCN (age 32) 2017, in contrast to earlier findings of T-cell lymphocytosis and increased fraction of DNT (less than 2%) could not be detected, Fig. 4. CD4 T-cells count (450 cells/µl) and neutrocyte count were moderately reduced, while the numbers of recent thymic immigrants were normal. B-cell count was markedly reduced and CD27 positive memory B-cells were absent, with markedly reduced somatic hypermutation in accordance with the CVID-like phenotype.
At time of progression from JCV-GCN to classical PML (age 33) 2018, a marked increase of PD1- positive CD4 T cells was observed (66%), suggesting T-cell exhaustion although paradoxically CD57 was not upregulated on CD4 T-cells. CD8 T-cells displayed moderate upregulation of PD-1 and marked upregulation of CD57.
Repeated biopsies from the skin lesions, were dominated by nodular dermal infiltration of T-cells devoid of B lymphocytes. T-cells displayed reduced expression of CD4, CD7, and CD8, the latter being more prevalent than CD4. Figure 1B-D. Double-negative T-cells could not be detected immunohistochemically, neither in the lesions nor in bone marrow biopsies. No clonal TCR rearrangements were detected. Interestingly, BCL2 expression was reduced indicating alterations in apoptosis signalling Fig. 1E.
By trio-exome sequencing FAS mutations were not detected in the patient or in the parents, suggesting that her previously diagnosed ALPS-FAS-FAS was caused by somatic mosaicism.
Exome sequencing identified a heterozygote de novo variant of unknown significance in RAG1 (NM_000448.2, c.478C > T, p.R160W, 0.0006983% allele frequency in gnomAD v3).
Virology
During illness, a total of 11 lumbar punctures were obtained, in which CSF remained acellular with normal CSF-protein, glucose and lactate- Fig. 1. Ten of the CSF samples were available for JCV quantification. DNA was isolated from CSF using QiaCube isolation and the JCV copy number was determined by quantitative PCR using a JCV standard with known copy number(15). Sequencing of the C terminus of the VP1 gene was performed after amplification of CSF samples using primer pair JC_F2469 (ACAGAGGAGCTTCCAGGGGA) and JC_R2629 (AAACCAAAGACCCCTCCCCC). Sequencing was carried out using the Nextera XT DNA Library Prep Kit (Illumina Inc., San Diego, United States) on the Illumina MiSeq platform. Here, a 16 bp deletion in the VP1-gene resulting in an open reading frameshift was demonstrated. This has previously been shown to be associated with JCV-GCN, (16), Fig. 5.
During the course of disease and treatment with cidofovir, CSF-JCV levels declined gradually from August 2017 to spring 2018, with a nadir CSF- JC viremia of 71–200 copies/ml, Fig. 3. From all CSF samples during this period, a mixed population of the JCV-GCV variant and the wild-type JCV type were detected by sequencing, with a large predominance of JCV-GCN and only few copies of the wildtype JCV present
However, at the progression to fatal PML, CSF-JCV levels increased 10-fold to an average of 2000 copies/ml at which point only wildtype-JCV without JCV-GCN was detected (Fig. 3).