Animals:
All animal procedures were conducted according to the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee at the American University of Beirut. Four-month-old non-obese type II female diabetic FVB-Tg (Ckm-1GF1R*K1003R)1Dlr/J mice weighing 22 to 25 grams (Diab) and age matching (Non-Diab) FVB-Tg adult female mice were kept in a temperature-controlled room and on a 12/12 hrs dark/light cycle and had standard chow and water access except when mice were placed in the exposure apparatus. Female mice were selected because of their established vulnerability to CS when compared to males. The ECIG, HTP, CS or exposure apparatus (ONARES, CH Technologies, USA) consists of a smoke generator, mixing/conditioning chamber and a twelve “nose only” rodent exposure carousel. One port was dedicated for sampling analysis, and the remaining 11 ports were used for animal exposure. Non-Diabetic mice were each divided into four groups: Control Non-Diab, Non-Diab + ECIG, Non-Diab + HTP and Non-Diab + CS.
Similarly, diabetic mice were divided into: Control Diab, Diab + ECIG, Diab + HTP and Diab + CS. Before placement in the exposure carousel, animals were acclimated to retainers for one week. As described previously [15], mice were then positioned in retainers and placed into the compartments of the carousel and received a continuous flow of air or air mixed with ECIG or HTP or CS aerosols. Mice were exposed for seven consecutive days, twice daily (am session and pm session). Each session lasted for 3 hrs.
At the conclusion of the experiment, animals were anesthetized, and the trachea was cannulated with polyethylene tubing. Animals were exsanguinated by severing the aorta. The diaphragm was dissected to allow free lung expansion. The left lung was clipped, and the right lung was then lavaged three times by slowly instilling 0.5 ml of PBS (Ca++ and Mg++ free, 37 °C) and then gradually aspirating the lavaged fluid. The lower lobe of the left lung was excised for pulmonary water content evaluation. The upper lobe of the left lung was fixed in formalin for pathology examination and TUNEL assay. The remaining right lung lobes were individually frozen in liquid nitrogen for RNA extraction.
Aerosol generation and exposure protocol
ECIG aerosol was generated using pre-filled V4L CoolCart (3.5 Ohm, 18 mg/mL labeled nicotine concentration) cartomizer cartridges, connected to an automatically activated 4.2 V Vapor Titan Soft Touch battery. The cartridges and batteries were purchased from an internet vendor (www.vapor4life.com) and passed a quality control test before their use. To ensure a steady aerosol generation during the 3-hour exposure sessions, cartridges and batteries were replaced every 30 min. ECIG puff parameters were set at 4 s puff duration, 1.2 L/min flow rate, and 14 s inter-puff interval, as in Talih et al. [16].
HTP aerosols were generated utilizing the ‘I quit smoking system’ (IQOS). The tobacco sticks, holders and the batteries were purchased from the internet vendor (www.IQOS.COM). The holder was fully charged before its use and the tobacco sticks were replaced every 6 min. The puff duration was 2 sec and the time in-between the puffs was 58 sec (i.e. 1 puff for 2 seconds every 1 minute). The puff depth was 35 ml. CS was generated from 3R4F cigarettes (University of Kentucky, Lexington, KY) with 0.9 mg TPM, 9.4 mg tar, and 0.726 mg nicotine per cigarette. The machine was set at one puff every minute with a duration of two seconds per puff and a volume of 35 ml per puff as well. With the current setup, cotinine levels were sampled from different groups. CS animals displayed levels that ranged from (40 to 55 ng/ml) as compared to ECIG and HTP groups where levels were consistently > 100 ng/ml. Cotinine levels signified adequate exposure to HTP and ECIG when compared to CS. With the current utilized protocol, non-diabetic animals would be exposed to levels that will result is measurable lung injury (17). The differential effects on Diabetic mice can then be ascertained.
Lung histology:
The upper lobe of the right lung was fixed in 10% buffered formalin, embedded in paraffin, sectioned and stained with hematoxylin and eosin (H&E). The degree of lung injury was determined based on the following histological features: alveolar interstitial wall edema, congestion, degree of inflammatory cell infiltration, and intra-alveolar edema.
Wet-to-dry lung weight
The left lower lobe was weighed and then placed in a 95 °C oven to dry for two days. The dried tissue was weighed, and the wet-to-dry ratio (W/D) was then calculated.
Albumin level
The concentration of albumin in the BALF was determined by an immune-turbidimetric assay as described before (16). Agglutination, caused by antigen/antibody complexes, was measured turbidimetrically at the clinical chemistry laboratory of the American University of Beirut Medical Center using a Hitachi 912 Autoanalyser (Roche Diagnostics, Basel, Switzerland).
Transcription expression profile of inflammatory mediators IL-1, IL-6, and TNF- α
Quantitative Polymerase Chain Reaction (q-PCR) was utilized to assess inflammatory mediators’ transcriptional levels. RNA was extracted from the lung using the TRIzol method
(Invitrogen, Carlsbad, CA, USA). Briefly, 1 ml of TRIzol reagent was used per 50–100 mg of a tissue sample, followed by chloroform extraction. RNA samples were precipitated and stored at -80 oC. RNA was quantified using a 260/280 nm absorbance ratio method. Total RNA (5 µg) was reverse-transcribed into first strand cDNA. Real time-PCR was performed using the iCycler (Bio-Rad Laboratories, Hercules, CA, USA) with SYBR Green. Specific primers (Tib-Molbiol, Berlin, Germany) were used to assess the expression of the inflammatory mediators in these tissues (IL-1β: Fw CACCTCTCAAGCAGAGCACAG, Rw GGGTTCCATGGTGAAGTCAAC; IL-6: Fw TCCTACCCCAACTTCCAATGCTC, Rw TTGGATGGTCTTGGTCCTTAGCC; TNF-α: Fw AATGGGCTCCCTCTCATCAGTTC, Rw TCTGCTTGGTGGTTTGCTACGAC). PCR products and their corresponding melting temperatures were analyzed using the iQ5 Optical System Software" (Bio-Rad Laboratories). Correction for loading was achieved by subtracting for local background and normalizing against the cDNA levels of the GAPDH housekeeping gene (GAPDH: Fw GTATTGGGCGCCTGGTCACC, Rw CGCTCCTGGAAGATGGTGATGG).
Assessment of Reactive Oxygen Species (ROS) production:
Dihydroethidium (DHE) (Invitrogen, Molecular Probes, USA) (10 µmol/L dissolved in DMSO) was applied to lung sections and incubated in a light-protected humidified chamber at 37 0C for 15 min. Fluorescent images of ethidium-stained tissue were scanned for a signal with a scanning confocal microscope (LSM 710, Zeiss, Germany). Ethidium bromide was excited at 488 nm, and fluorescence was detected at 560 nm long-pass filter. Mean fluorescence intensity of the digitalized image was measured with Image software [National Institutes of Health (NIH), Bethesda, MD] for quantification as previously described [16].
Assessment of apoptosis – TUNEL assay
The terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay was used to monitor the extent of DNA fragmentation. Fluorescein-conjugated dUTP incorporated in nucleotide polymers was detected and analyzed using fluorescence microscopy (Zeiss LSM 710, Germany). Positive and negative controls were used to verify the specificity of the TUNEL assay. TUNEL-positive nuclei were distinguished from the TUNEL-negative nuclei by counterstaining with Hoechst 33258.