2.1 Materials
Cell counting kit 40203ES60 was made by Yeasen Biotech Co.Ltd (Shanghai,China); anti-AKR1B10 antibody ab96417 was made by abcam (Cambridge, UK),GAPDH Mouse Monoclonal antibody 60004–1-lg was made by Proteintech Group.Inc (Chicago,U.S.); Phospho-NF-κB p65(Ser536) (93H1) Rabbit mAb #3033 was made by Cell Signaling Technology (Massachusetts,U.S.); NF-κBp65(D14E12)XP Rabbit mAb #8242 was made by Cell Signaling Technology (Massachusetts,U.S); IκB-α antibody (CST#9242);NE-PER™ Nuclear and Cytoplasmic Extraction Reagents 78835 was made by Thermo Scientific (Massachusetts,U.S).The TMA specimens were manufactured by Shanghai Outdo Biotech ( Shanghai, China).
2.2 Cell culture
Colon cancer HT–29 cells were obtained from the Cancer Research Center of Xiamen University. Cells were cultured in DMEM supplemented with 10% FBS and maintained at 37°C under an atmosphere of 95% air and 5% CO2.
2.3 Oncomine database analysis
An online microarray database-oncomine (http://www.oncomine.org) was used to compare AKR1B10 mRNA levels between colon cancer tissues and normal tissues. The thresholds were set as follows: p-value: 0.0001; fold change: 2; gene rank: 10%; analysis type: cancer vs. normal analysis.
2.4 Immunohistochemical analysis
The expression of AKR1B10 in paraffin‑embedded tumor samples were determined by Immunohistochemistry (IHC) staining of tissue microarrays. IHC was used a standard avidin-biotin-peroxidase method. TMAs were deparaffinizedin xylene and then dehydrated in gradient concentrations of ethanol. In a microwave oven for 5min by used preheated sodium citrate buffer. After rinsed with distilled water, in 3% hydrogen peroxide for 10min, and incubated the sections with normal goat serum for 10min at room temperature in order to eliminate nonspecific staining. The sections were incubated with rabbit anti-AKR1B10 antibody overnight at 4°C, and then incubated with secondary antibody at 37°C for 30min. Subsequently, the sections were incubated with the avidin-biotin-peroxidasecomplex for another 10min. Then the sections were stained with 3, 3-diaminobenzidine (DAB) for 1–5min and counterstained with hematoxylin. Negative controls were obtained by replacing the primary antibody with PBS. Images were acquired on Motic VM1 and processed with the Motic DSAssistant Lite software. Immunohistochemical staining was blindly scored by two pathologists.
2.5 AKR1B10 knockdown by stable transfection
The shRNA primers were designed according to the pLV-RNAi system and the sequences used were as follows:
shAKR1B10#1: GAACAAACCTGGACTGAAATA
shAKR1B10#2: GGTTCTGATCCGTTTCCATAT
The lentivirus vector pLV-AKR1B10-Puromycin or plv-control-Puromycin was transfected into 293T cells together with auxiliary plasmids pMDLg/pRRE, pVSV-G and pRSC-Rev to package lentivirus. After infected by the lentivirus, shAKR1B10 cells and shcontrol cells were screened out through adding puromycin into the mediums.
2.6 Reverse transcription (RT)-PCR
RNA was extracted and prepared using TRIzol and cDNA was synthesized using the SuperScript III First-Strand Synthesis Supermix Kit. Quantitative analysis of each gene expression was performed on Light Cycler with SYBR Green detection with specific oligonucleotide primers. Gene expression was normalized using GAPDH as an internal control. The primers used were as shown below:
IL1α: 5/-TGTATGTGACTGCCCAAGATG–3/ (forward)
5/-TTAGTGCCGTGAGTTTCCC–3/ (reverse)
IL6: 5/-CCACTCACCTCTTCAGAACG–3/ (forward)
5/-CATCTTTGGAAGGTTCAGGTTG–3/ (reverse)
GAPDH: 5/-ACATCGCTCAGACACCATG–3/ (forward)
5/- TGTAGTTGAGGTCAATGAAGGG–3/ (reverse).
2.7 Overexpression and mutant plasmids establishment
Human AKR1B10 cDNA was used to design PCR primers. PCR primers used were as follows:
AKR1B10-N-F: AGAGAATTCGGATCCGCCACGTTTGTGGAGCTCAGTACCAA
AKR1B10-N-R: TGGCTCGAGCCCGGGTCAATATTCTGCATTGAAGGGATAGT
The eukaryotic expression plasmid pLV-n-Flag-AKR1B10 of AKR1B10 was obtained by LIC ligation. Using this plasmid as a template, pLV-n-Flag-AKR1B10 (K125L) was obtained by using the AKR1B10 enzyme active point primers:
AKR1B10-K125L-F: CCTTTTCCCCTTAGATGATAAAGG
AKR1B10-K125L-R: CCTTTATCATCTAAGGGGAAAAGG
The plasmids established above were transfected into the AKR1B10 knockdown cell line.
2.8 Western blot analysis
Colon cancer HT–29 cells were lysed in RIPA lysis buffer supplemented with a protease inhibitor PMSF to extraction total protein. Nuclear lysates were isolated using the NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific). Protein lysates were separated on 10% or 13% SDS-PAGE gels. And then transferred to PVDF membranes and blocked by 5% BSA for 1h. Afterwards, incubation was carried out with the primary antibodies overnight at 4°C. After that, washed with TBST 10min, repeated this at least three times. Next, incubation was carried out with secondary antibodies for 1h at room temperature. The membranes were washed 10min and repeated for three times. Immunoreactive bands were detected using electrochemiluminescence (ECL).
2.9 Cell proliferation assay and cell colony formation assay
The viability of cells was measured by using cell counting kit (CCK8) assay. For cck8, 5000 cells with 100μl of medium were seeded into each well of 96-well plate. Cells were cultured for 24, 48 and 72 h at 37˚C. Finally, 10ul cck8 sodium was added to each well and incubated for 2 h at 37 ˚C. Then the optical density (OD) was measured at a wavelength of 450nm.
For cell colony formation assay, 50,100,200 cells with 5000μl of medium were seeded into 6cm plate, respectively. The culture medium was changed every three days. When visible clones appeared after 2 to 3 weeks, the medium was removed, washed twice with PBS, and air-dried for 10min. Then 100% formaldehyde was fixed at room temperature for 15–20min. Finally, stained with Giemsa stain for 10min. Took pictures and counted the number of colonies formed.
2.10 Statistical analyses
Immunohistochemical AKR1B10-stainings were compared with subgroups by use of the Kaplan-Meier. P-values of <0.05 were considered statistically significant. For statistical analyses, we used R for Windows.