Bromide impairs the circadian clock and glycolytic homeostasis via disruption of autophagy in rat H9C2 cardiomyocytes

doi:10.21203/rs.2.17574/v2

PDF

Research article

Bromide impairs the circadian clock and glycolytic homeostasis via disruption of autophagy in rat H9C2 cardiomyocytes

https://doi.org/10.21203/rs.2.17574/v2

This work is licensed under a CC BY 4.0 License

Journal Publication

published 19 Jun, 2020

Read the published version in BMC Molecular and Cell Biology →

You are reading this latest preprint version

Background: Trace elements function as essential cofactors that are involved in various biochemical processes in mammals. Autophagy is vital for nutrient supplement, which is an important Zeitegber for the circadian homeostasis in heart. Here, we considered the possibility that autophagy, as well as the cardiomyocyte clock and glycolysis are interlinked. Detrimental effects were observed when cardiac system is exposed to bromine containing drugs. This study investigated the effects and mechanisms of bromide on the circadian clock and glycolytic metabolism of H9C2 cardiomyocytes.

Methods: H9C2 cardiomyocytes were incubated with sodium bromide at indicated doses for 24 hours, cell viability, mRNA expression of clock genes, glycolytic genes and autophagic genes were examined using various cellular and molecular approaches. Also, circadian oscillation rhythm of these genes was determined by serum shock with sodium bromide or equal amounts of sodium chloride.

Results: Bromide does not affect cell viability and apoptosis of H9C2 cardiomyocytes. Bromide dampens the clock and glycolytic ( Hk2 and Pkm2 ) gene expression rhythmicity in a dose-dependent manner. Additionally, bromide inhibits autophagic process in H9C2 cardiomyocytes. In contrast, rapamycin (an autophagy inducer) dramatically restores the inhibitory effect of NaBr on the mRNA expression levels of clock genes ( Bmal1 , Cry1 and Rorα ) and glycolytic genes ( Hk2 and Pkm2 ).

Conclusions: Our results reveal that bromide represses the clock and glycolytic gene expression patterns, partially through inhibition of autophagy.

General Cell Biology & Physiology

Molecular Biology

Bromide

H9C2

Circadian clock

Glycolysis

Autophagy

Sufficient trace elements play important roles in maintaining our body healthy. Recently, it has been well established that the deficiency of metal ions, such as iron, zinc and copper, leads to various diseases including heart failure, diabetes and bone marrow hematopoiesis (1-3). Of note, bromine is a unique trace element that possessing negative charge in the biosphere. In the past 20^th century, the environmental doses of bromide increased due to the salt-mining wastes and the degradation products of fumigants, causing an inevitably exposure of bromide for the general population (4). Hence, as a residue in food, the toxicological and physiological evaluations of bromide are raring necessary.

Bromide is widely used in the drug development. For example, triple bromide elixir functions as an adjunctive antiepileptic drug to treat the children whose seizure disorders were intractable to other antiepileptic therapy (5). Tiotropium bromide (Spiriva^®) is a long-term anticholinergic bronchodilator that maintains bronchodilation for at least one day (6). More importantly, the concentrations of bromide are negatively correlated with the lipids including TG, TC, and HDL-C in the human and rat plasma (6). Coincidence with these findings, bromide exhibits beneficial effects on the FFA-induced lipid dysregulation in mouse hepatocytes_,increasing its possibility in the treatment of metabolic disorders such as hepatic steatosis (7). All these studies implicate that bromide could be developed as a promising drug in the treatment of various diseases. However, the neuromuscular blocking drugs (NMBD), pancuronium bromide shows a short-lasting cardiovascular stimulation after a high-dose injection, indicating the potential detrimental effects of bromide on the cardiac system (8). Given that bromide penetrates the cell membrane through the chloride channel which is a vital ion channel in the cardiovascular system (9, 10), it is of great interest to track the pharmacological evidences of bromide on cardiac system and its underlying mechanisms.

For decades, the circadian clock has been demonstrated to maintain the cardiac homeostasis, such as heart rate and blood pressure (11). Clinical investigations indicate that circadian disruption in shift workers is associated with increased cardiovascular morbidity and mortality blood pressure variation shift workers (12). These findings are confirmed by animal studies that cardiomyocyte-specific Bmal1 knockout and Clock mutant mice suffer from age-onset cardiomyopathy, early mortality and sinus bradycardia (13). On the other hand, to meet energy demands, cardiomyocytes dynamically reprogram fuel and energize their metabolic capacity in response to environmental and physiological cues (14). Importantly, the substrate availability varies in a 24-h (hour) day, which directly influences the energy supplement. Collectively, these findings demonstrate a tight link between the circadian clock and homeostasis of the cardiac system. However, in general, the molecular process which integrates the cardiac circadian clock and metabolism in response to various external stimulus, such as bromide, remains unknown. Here, we aimed to investigate the effects of bromide on the H9C2 cardiomyocyte survival and its circadian physiological homeostasis with the hope of elucidating the mechanism of its cardiovascular medicinal potential.

Bromide does not affect survival and apoptosis of H9C2 cardiomyocytes

To investigate the effects of bromide on the cardiomyocytes, we firstly assessed the toxicity of NaBr. As shown in Fig. 1a, CCK-8 analysis demonstrated that NaBr was not toxic to H9C2 cardiomyocytes when the concentration was up to 600 μM. Besides, similar tendency was observed in isolated rat neonatal primary cardiomyocytes when treated with the same doses of NaBr (sFig. 1). Hence, the doses range from 50 μM to 400 μM were regarded as safe and were chosen for the subsequent experiments. In addition, bromide did not affect mRNA expression levels of apoptosis-associated factors Bcl-2, Bax and Caspase-3 (Fig. 1b). Consistently, the active form level of Caspase-3 (the cleaved type) was not altered by NaBr incubation (Fig. 1c and d). These results implied that cell apoptosis was not regulated in response to bromide stimulation.

Bromide dampens clock gene expression in H9C2 cardiomyocytes

As shown in Fig. 2a and b, treatment of NaBr at the doses of 200 μM and 400 μM robustly inhibited mRNA levels of key clock genes Bmal1, Cry1 and Rorα in a dose-dependent manner. In particular, 400 μM NaBr inhibited mRNA levels of Bmal1 by 41.5%, Cry1 by 59.5% and Rorα by 43.8% respectively. The protein expression of these genes showed similar trends in response to NaBr (Fig. 2a-c). Also, we detected other clock genes expression upon NaBr treatment in sFig 2. Of note, serum shock has been demonstrated to induce rhythmic clock gene expression in various cells. Here, in our system, serum shock also resulted in a robust oscillation of clock genes including Bmal1, Cry1 and Rorα. etc (Fig. 2d, h and l). However, the Per1 did not exhibit an obvious circadian oscillation in H9C2 cardiomyocytes, which is in consistent with previous findings (Fig. 2f). Notably, NaBr treatment did not alter the phase of oscillation patterns of clock genes, but dampened the amplitudes at most checked time-points, except for Clock, whose amplitudes was intensified by NaBr incubation (Fig. 2d-m and Table 2). All these findings suggested the detrimental role of bromide in dampening the circadian clock in H9C2 cardiomyocytes.

Bromide inhibits glycolytic gene expression in H9C2 cardiomyocytes

Given that circadian disruption in cardiomyocytes is closely correlated with the transition of fuel utilization from lipid oxidation to glycolysis (15), it is of great interest to identify the impact of bromide on the glycolysis. Unexpectedly, NaBr did not increase, however, dose-dependently decreased mRNA expression levels of Hk2 and Pkm2, which are hallmarks of glycolysis (Fig. 3a). Similar results were obtained in the protein levels of these genes (Fig. 3b and c). In contrast, PPARα, an important transcriptional factor that activates fatty acid β-oxidation in heart, was not altered upon NaBr incubation (Fig. 3a-c). Furthermore, serum shock also induced significant oscillation of Hk2, Pkm2 and Pparα mRNAs. However, bromide dampened the amplitudes of Pkm2 and Pparα, while leaving Hk2 unchanged in both its phase and amplitude, compared to NaCl-treated group (Fig. 3d-f and Table 3).

Bromide inhibits autophagy in H9C2 cardiomyocytes

Autophagy is a cellular process that delivers cytosolic components to lysosomes for degradation in response to metabolic stress, such as starvation, to provide a source of nutrients and metabolic fuel (16). As shown in Fig. 4a and b, NaBr dramatically reduced the formation of autophagic puncta evidenced by using adenovirus expressing GFP-RFP-LC3. Coincidence with these findings, NaBr significantly reduced the LC3 II/LC3 I ratio and mRNA expression levels of Ulk1, Gabarapl1 and Atg5, which are key factors in regulating the autophagosome formation (Fig. 4c). Consistently, the protein expression levels of ULK1 and ATG5 were inhibited by NaBr in a dose-dependent manner (Fig. 4d and e). In addition, serum shock successfully induced rhythmic oscillation of Ulk1, Gabarapl1 and Atg5 genes expression in H9C2 cells. While the amplitudes of Ulk1 and Atg5 were dampened, bromide modestly altered the Gabarapl1 expression oscillation pattern (Fig. 4f-h and Table 4).

Autophagy mediates the inhibitory effect of bromide on the circadian clock and glycolytic gene expression in H9C2 cardiomyocytes.

To investigate the role of autophagy in the regulation of metabolism and autophagy in H9C2 cardiomyocytes, we incubated cells with 100 nM rapamycin (inhibitor of mTOR activity, as an autophagy inducer). As shown in Fig. 5a and b, rapamycin restored the inhibitory effect of NaBr on the mRNA expression levels of clock genes (Bmal1, Cry1 and Rorα) and glycolytic genes (Hk2 and Pkm2). Also, protein levels of these genes showed similar tendency (Fig 5c-e). Additionally, the phosphorylation of mTOR protein was slightly inducd by NaBr treatment (increased to ~1.4 folds), which was then retarded by rapamycin incubation (Fig 5c and f), indicating that bromide may inhibit autophagy partially through activating mTOR pathway, and further dampening clock and glycolytic gene expression and their rhythmicity (Fig. 6). In addition, another autophagy inducer, QX77, also partially reversed the inhibitory effects of NaBr on the mRNA and protein expression levels of clock genes (Bmal1, Cry1 and Rorα) and glycolytic genes (Hk2 and Pkm2) (sFig 3). Given that the autophagy is vital for the maintaining homeostasis in the physiological state, we treated H9C2 cardiomyocytes with 1 μM H₂O₂ and 400 μM NaBr. As shown in sFig 4, NaBr-treated H9C2 cardiomyocytes are susceptible to H₂O₂ stimuli, indicating that the bromide senses the cardiomyocytes to external toxic signals.

As an essential trace element, bromide maintains the redox homeostasis at a serum concentration of 42~61 μM in healthy individuals (17, 18). Clinically, high dose bromide (~2.1 mM) is used to treat the epilepsy. In 1990s, bromide was thought to be safe with a LD50 at 7000mg/kg in rats after acute gavage (19). However, potential toxicity was observed in the endocrine and reproductive system. Animal experiments revealed that 90-day consecutive gavage of high-dose bromide (14 900 mg/kg) increased the weights of thyroid adrenal and prostate and induced pathological changes in pituitarium, thyroid, testicle and ovary (19). More importantly, detrimental effects were observed in cardiac system. For example, bromide-containing drugs pancuronium which is a neuromuscular-blocking drug, induces temporary cardiovascular stimulation, accompanied with rapid up-regulations in heart rate, average arterial blood pressure and cardiac output in rats (8). Rats feed with diet containing 0.8% brominate vegetable oil (BVO) show enlarged heart and dissolved cardiomyocytes, further inducing the degenerative changes of the myocardium (20). In our study, we found that bromide did not alter the survival and apoptosis of H9C2 cardiomyocytes, however, affected the clock and metabolic homeostasis. All these findings indicated the cardiac system are sensitivity to bromide stimulation. Hence, bromide may have potential harmful effect on the cardiac system.

Given the potential toxic effects of bromide on the cardiovascular system, our study was aimed to clarify the impact of bromide on the cardiomyocytes in vitro. In our study, we found that bromide did not alter the cell viability and apoptosis, whereas decreased the autophagy and glycolysis. More importantly, treatment of bromide increased susceptibility to the H₂O₂-induced toxicity of H9C2 cardiomyocytes. On the other hand, chronotherapy and chronopharmacology, which functioned to minimize the drug toxicity and maximize drug efficacy and tolerance, are based on the circadian system. Therefore, we investigated the effect of bromide on the cardiomyocytes’ clock to provide experimental and theological basis for the potential effective timing for the bromide-containing drugs in the future study.

Autophagy is a crucial evolutionarily conserved biological process responsible for eliminating long half-life proteins, damaged organelles and pathogens (21). Autophagy deficiency has been demonstrated in the pathogenesis of various diseases, such as cancer (22), diabetes (23), and heart failure (24). Thus, autophagy is vital for cellular homeostasis and nutrient supplement. Given that the nutrient is a important Zeitegber for the circadian homeostasis in heart, here we considered the possibility that autophagy, as well as the cardiomyocyte clock and glycolysis are interlinked. In our study, rapamycin-induced autophagy increased the clock and glycolytic gene expression in response to bromide stimulation, indicating that autophagy indeed integrates the circadian clock and glycolysis in H9C2 cells. On the other hand, trace elements serve as a pivotal factor to regulate autophagy. For example, the aggravating effect of selenium deficiency on T-2 toxin-induced damage on primary cardiomyocyte results from a reduction of protective autophagy (25). Therefore, bromide, as a unique trace element, may correlate with autophagic process in the heart. In our study, we found that bromide inhibited autophagic pathway through increasing the phosphorylation of mTOR protein. In contrast, activation of autophagy by rapamycin retarded bromide-induced impairment of the circadian clock and glycolysis in H9C2 cells, implicating the mediator roles of autophagy in bromide signals. At the molecular level, autophagy induces clock gene CRY1 protein degradation to regulate the liver clock and glucose metabolism (26). However, rapamycin-induced autophagy transcriptionally increased the CRY1 expression in H9C2 cells, implying that autophagy regulates CRY1 expression at both posttranscriptional and transcriptional levels according to the tissue specificity. The effects of autophagy in mediating the bromide signals to the circadian clocks and glycolysis of H9C2 cardiomyocytes were further confirmed by another autophagic activator QX77.

Our current discoveries demonstrated that the effects of bromide on the circadian and glycolytic gene oscillation in H9C2 cardiomyocytes, highlighting the mediating roles of autophagy/mTOR in the bromide signal relay. Our findings demonstrated the detrimental, but not toxic effects of high-dose bromide, and suggested that the potential side-effect of bromide-containing drugs on cardiac system. The cardiac safety of bromide should be considered in future drug development.

Cell culture

The rat H9C2 cardiomyocytes were cultured at 37 °C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, high glucose, Gibco-Invitrogen, Carlsbad, USA), supplemented with 1% antibiotic-antimycotic (10 000 U/mL of penicillin, 10 000 mg/mL of streptomycin) and 10% fetal bovine serum (FBS, Gibco-Invitrogen), and were used between passages 15 to 25. To examine the autophagic status in response to bromide stimulation, we infected the cells with the adenovirus expressing GFP-RFP-LC3 for 24 h (hours), and treated with bromide or vehicle (equal molar sodium chloride) for another 24 h. The GFP-RFP-LC3-positive cells were examined by a Nikon fluorescence microscope (ECLIPSE, Ts2R-FL). Rat neonatal primary cardiomyocytes were isolated from Wistar rats age 1-10 days by collagenase II, then cultured at 37 °C and 5% CO2 in DMEM, and supplemented with 2% antibiotic-antimycotic (10 000 U/mL of penicillin, 10 000 mg/mL of streptomycin) and 10% FBS.

CCK-8 toxicity assay

CCK-8 assay was performed to analyze potential toxic effects of sodium bromide (NaBr; Sigma-Aldrich, Germany) on H9C2 cardiomyocytes. Briefly, 1×10⁴ cells were seeded into each well of a 96-well plate and were cultured at 37°C overnight. After synchronization with serum-free DMEM, cells were transferred into 100 μL serum-free DMEM containing either NaBr or equal amounts of sodium chloride (NaCl, positive control) at indicated concentrations (ranging from 10 μM to 600 μM) and incubated for another 24 h. Then, 10 μL CCK-8 reagent (Jiancheng, Nanjing, China) was added to each well and incubated at 37°C for 4 h. Finally, a microplate reader was used to measure the absorbance at 450 nm.

Serum shock

The media of confluent cultures was replaced with DMEM plus 50% horse serum. After 2 h shock, the cells were washed twice with PBS and incubated with serum-free DMEM containing 400 μM NaBr or NaCl. Cell samples were collected at 4-h intervals. Total RNA was extracted and processed for reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis.

RT-qPCR analysis

Total RNA from cells was isolated using Trizol reagent (Invitrogen, Carlsbad, California, USA), reverse transcribed with the PrimeScript RT reagent kit (Takara, Tokyo, Japan), and analyzed by real-time quantitative PCR using 2×ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) according to the manufacturer’s instructions. The Primers for rat GAPDH were included for normalization. A complete list of Primers was shown in Table 1 and synthesized by Generay Biotech Co., Ltd. (Shanghai, China).

Western blotting analysis

For protein analysis, cells were lysed in RIPA buffer. The protein concentration was quantified with a BCA Protein Quantitation Assay Kit (Beyotime Biotech., Shanghai, China). Equal amounts of protein were loaded and separated by 10% SDS-PAGE and then transferred onto a PVDF membrane (Millipore Corp., Billerica, MA, USA). The membranes were incubated overnight with appropriate primary antibodies at 4°C. Bound antibodies were then visualized using horseradish peroxidase-conjugated secondary antibodies. A quantitative analysis was performed by using ImageJ software (U.S. National Institutes of Health). For the antibody information, the antibodies against CRY1, HK2 and PKM2 were purchased from Proteintech (Chicago, IL, USA). Anti-RORα were obtained from Santa Cruz Biotechnology (CA, USA). The antibodies against LC3II/I, BMAL1, ULK1 and ATG5 were purchased from Bioworld Technology, Inc. (Nanjing, China). The antibody against β-ACTIN was derived from Servicbio Technology Co., Ltd (Wuhan, China). The secondary antibodies were obtained from Santa Cruz Biotechnology (CA, USA).

Statistical analysis

Groups of data were presented as the means ± standard deviation (SD). Data were analyzed by using one-way ANOVA followed by Fisher’s LSD post hoc test. Calculations were performed by using Origin 8 software (version 8.6, OriginLab, Northampton, MA, USA). A value of P<0.05 was considered statistically significant. Circadian variations, including amplitude andvphase shift, were calculated by fitting a cosine-wave equation [y = baseline + (Amplitude × Cos (2 × π × (x-phaseshift)/24)] on clock gene expression, with a fixed 24-h period (detailed data for the oscillation of clock genes were presented in Supplementary Table 2-4). Time series data were analyzed using one-way or two-way ANOVA followed by Bonferroni’s post hoc test. A p-value of less than 0.05 was considered to be statistically significant. Unless otherwise indicated, the statistics was performed using Student’s t-test when only two groups were compared.

CCK-8: Cell counting kit-8; NaBr: Sodium bromide; NaCl: Sodium chloride; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; CRY: Cryptochrome; HK2: Hexokinase 2; PKM2: Pyruvate kinase M 2; RORα: RAR-related orphan receptor α; BMAL1: Brain and muscle arnt-Like Protein 1; ULK1: Unc-51 like kinase 1; ATG5: Autophagy related 5; PPARα: Peroxisome proliferator activated receptor α; Garabapl1: GABA(A) receptor associated protein like 1; mTOR: mechanistic target of rapamycin kinase; Clock: Circadian locomotor output cycles kaput; Per: Period; Rev-erb: nuclear receptor subfamily 1, group D; Dbp: D site albumin promoter binding protein.

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable

Availability of data and material

The datasets supporting the conclusions of this article are included within the article.

Competing interests

The authors declare that they have no competing interests.

Funding

This project was funded by Jiangsu Provincial Youth Medical Key Talents Project (QNRC2016431), the Research Fund for the Technology Development Project of Nanjing Medical University (grant no. NMUB2018148). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Authors' contributions

YCJ, YG and XWZ designed the study. YCJ, YG, HX, WTY, XYT, XFZ and XJX performed the experiments and analyzed the data. YCJ and XWZ wrote the manuscript and critically revised it. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Author details

¹The Affiliated Huai’an No.1 People’s Hospital of Nanjing Medical University, Huai'an, 223300 Jiangsu, China.

Jankowska EA, Rozentryt P, Witkowska A, Nowak J, Hartmann O, Ponikowska B, et al. Iron deficiency: an ominous sign in patients with systolic chronic heart failure. European heart journal. 2010;31(15):1872-80.
Fukunaka A, Fujitani Y. Role of zinc homeostasis in the pathogenesis of diabetes and obesity. International journal of molecular sciences. 2018;19(2):476.
Myint ZW, Oo TH, Thein KZ, Tun AM, Saeed H. Copper deficiency anemia. Annals of hematology. 2018;97(9):1527-34.
Soltermann F, Abegglen C, Gotz C, Von Gunten U. Bromide sources and loads in Swiss surface waters and their relevance for bromate formation during wastewater ozonation. Environmental science & technology. 2016;50(18):9825-34.
Holtkamp M. Other less commonly used antiepileptic drugs. The treatment of epilepsy 4th ed West Sussex: Wiley. 2015:689-700.
Halpin DM, Kaplan AG, Russell RK. Why choose tiotropium for my patient? A comprehensive review of actions and outcomes versus other bronchodilators. Respiratory medicine. 2017;128:28-41.
Shi Y, Zhang W, Cheng Y, Liu C, Chen S. Bromide alleviates fatty acid‐induced lipid accumulation in mouse primary hepatocytes through the activation of PPARα signals. Journal of cellular and molecular medicine. 2019;23(6):4464-74.
Docherty J, McGrath J. Sympathomimetic effects of pancuronium bromide on the cardiovascular system of the pithed rat: a comparison with the effects of drugs blocking the neuronal uptake of noradrenaline. British journal of pharmacology. 1978;64(4):589-99.
Anderson MP, Gregory RJ, Thompson S, Souza DW, Paul S, Mulligan RC, et al. Demonstration that CFTR is a chloride channel by alteration of its anion selectivity. Science. 1991;253(5016):202-5.
Gadsby DC, Nagel G, Hwang T. The CFTR chloride channel of mammalian heart. Annual Review of Physiology. 1995;57(1):387-416.
Gubin D, Weinert D, Rybina S, Danilova L, Solovieva S, Durov A, et al. Activity, sleep and ambient light have a different impact on circadian blood pressure, heart rate and body temperature rhythms. Chronobiology international. 2017;34(5):632-49.
Chellappa SL, Vujovic N, Williams JS, Scheer FA. Impact of Circadian Disruption on Cardiovascular Function and Disease. Trends in Endocrinology & Metabolism. 2019.
Young ME, Brewer RA, Peliciari-Garcia RA, Collins HE, He L, Birky TL, et al. Cardiomyocyte-specific BMAL1 plays critical roles in metabolism, signaling, and maintenance of contractile function of the heart. Journal of biological rhythms. 2014;29(4):257-76.
Dong D, Li L, Gu P, Jin T, Wen M, Yuan C, et al. Profiling metabolic remodeling in PP2Acα deficiency and chronic pressure overload mouse hearts. FEBS letters. 2015;589(23):3631-9.
Martino TA, Young ME. Influence of the cardiomyocyte circadian clock on cardiac physiology and pathophysiology. Journal of biological rhythms. 2015;30(3):183-205.
Kaur J, Debnath J. Autophagy at the crossroads of catabolism and anabolism. Nature reviews Molecular cell biology. 2015;16(8):461.
Corrigan FM, Skinner ER, MacIntyre F, Ijomah G, Holliday J, Horrobin DF, et al. Plasma bromine concentrations and lipid profiles. Clinica chimica acta; international journal of clinical chemistry. 1991;204(1-3):301-4.
Canavese C, De Costanzi E, Stratta P, Sabbioni E. A role for bromine deficiency in sleep disturbances of long-term dialysis patients. American journal of kidney diseases : the official journal of the National Kidney Foundation. 2006;48(6):1018-9; author reply 9.
Flury M, Papritz A. Bromide in the natural environment: occurrence and toxicity. Journal of Environmental Quality. 1993;22(4):747-58.
Lawrence JF, Chadha RK, Iverson F, McGuire P, Conacher HB. Brominated fatty acid distribution in tissues and fluids of rats fed brominated vegetable oils. Lipids. 1984;19(9):704-7.
Randow F, Münz C. Autophagy in the regulation of pathogen replication and adaptive immunity. Trends in immunology. 2012;33(10):475-87.
White E. The role for autophagy in cancer. The Journal of clinical investigation. 2015;125(1):42-6.
Xu X, Kobayashi S, Chen K, Timm D, Volden P, Huang Y, et al. Diminished autophagy limits cardiac injury in mouse models of type 1 diabetes. Journal of Biological Chemistry. 2013;288(25):18077-92.
Lavandero S, Chiong M, Rothermel BA, Hill JA. Autophagy in cardiovascular biology. The Journal of clinical investigation. 2015;125(1):55-64.
Chen X, Xu J, Liu D, Sun Y, Qian G, Xu S, et al. The aggravating effect of selenium deficiency on T-2 toxin-induced damage on primary cardiomyocyte results from a reduction of protective autophagy. Chemico-biological interactions. 2019;300:27-34.
Toledo M, Batista-Gonzalez A, Merheb E, Aoun ML, Tarabra E, Feng D, et al. Autophagy regulates the liver clock and glucose metabolism by degrading CRY1. Cell metabolism. 2018;28(2):268-81. e4.

Table 1. The list of primer sequences for qPCR analysis

Gene	Primer sequence ( 5'-3' )
Bax	Forward:	GAACTGGACAACAACATGGAG
Bax	Reverse：	CAAAGTAGAAAAGGGCAACC
Bcl-2	Forward:	AGGGGCTACGAGTGGGATA
Bcl-2	Reverse：	CAGGCTGGAAGGAGAAGATG
Caspase-3	Forward:	GTATTGAGACAGACAGTGGAA
Caspase-3	Reverse：	GTGCGGTAGAGTAAGCAT
Bmal1	Forward:	TGCCACCAACCCATACAC
Bmal1	Reverse：	TCTTCCCTCGGTCACATC
Clock	Forward:	GACAAGGACAAAGCAAAAAG
Clock	Reverse：	CAGGAAGCATAGACCCCA
Per1	Forward:	TTGCAAACGGGATGTGTTT
Per1	Reverse：	CAGGCGAGATGGTGTAGTAGAG
Per2	Forward:	TACACCACCCCTTACAAGCT
Per2	Reverse：	CACTGACACGGCAGAAAAAA
Cry1	Forward:	AAGCCCAACTGGACTGAG
Cry1	Reverse：	AAAGGGGAGGGGAACTAT
Cry2	Forward:	TTGGGAAAGAACGGGATG
Cry2	Reverse：	CGCTTGTAGGTAAGGGGTG
Rev-erbα	Forward:	GCTCCCCTTCTTCTGCTTC
Rev-erbα	Reverse：	CTGTCTTCCATGGCCACTT
Rev-erbβ	Forward:	AGAAGTGTCTGTCCGTGGG
Rev-erbβ	Reverse：	AGGAGGGGTGCTTTTGAT
Rorα	Forward:	AAGAACCACCGAGAAGATG
Rorα	Reverse：	GGAAAATGGAGTCGCACA
Dbp	Forward:	AGAGACGCAAGAAGACTCAAGG
Dbp	Reverse：	ACAGCACGGTAGTGGGACAG
Hk2	Forward:	GGGACGACGGTACACTCAA
Hk2	Reverse：	CCGCTAATCATCTTCTCAAACA
Pkm2	Forward:	GACACGCAATCCCCAGACA
Pkm2	Reverse：	CCAAGTTCACACGAAGATCAAC
Pparα	Forward:	AGTACAGATGAGTCCCCTGG
Pparα	Reverse：	CGAATAGTTCGCCGAAAG
Ulk1	Forward:	GACAGCCTACAGGAGAAACCT
Ulk1	Reverse：	GGGGAGCCCACAGTAAATA
Gabarapl1	Forward:	ATCTGGATAAGAGGAAGTACC
Gabarapl1	Reverse：	GACAAAGAAGAATAAGGCG
Atg5	Forward:	GAGCCATACTATTTGCTTTTGC
Atg5	Reverse：	TCAGGGGTGTGCCTTCAT
Gapdh	Forward:	TGGAAAGCTGTGGCGTGA
Gapdh	Reverse：	GGATACATTGGGGGTAGGAA

Gene name	Amplitude		p value for Amplitude	Phaseshift		p value for Phaseshift	Δphase (NaBr vs. NaCl)	Δphase Average
Gene name	NaCl	NaBr	p value for Amplitude	NaCl	NaBr	p value for Phaseshift	Δphase (NaBr vs. NaCl)	Δphase Average
Bmal1	0.21	0.11	0.016164033	-2.06	-2.34	0.150573265	-0.28	-0.2233
	0.16	0.14		-1.96	-2.09		-0.14
	0.19	0.11		-1.77	-2.03		-0.26
Clock	0.05	0.15	0.003405324	-1.78	-13.36	0.000647174	-11.59	-10.096
	0.07	0.13		-1.60	-11.73		-10.13
	0.09	0.15		-1.21	-9.78		-8.58
Per1	0.23	0.27	0.088128325	-0.58	-0.26	0.014389232	0.32	0.2316
	0.22	0.26		-0.40	-0.21		0.19
	0.23	0.23		-0.45	-0.27		0.19
Per2	0.29	0.35	0.014460176	-0.66	-0.70	0.395545208	-0.04	0.05287
	0.31	0.37		-0.65	-0.60		0.05
	0.33	0.38		-0.65	-0.51		0.14
Cry1	0.34	0.34	0.139537843	3.32	3.30	0.289981592	-0.01	0.175
	0.36	0.33		3.37	3.55		0.18
	0.39	0.33		3.43	3.79		0.36
Cry2	0.32	0.33	0.568007384	-3.37	-3.67	0.240332949	-0.30	-0.426
	0.30	0.28		-2.96	-3.45		-0.49
	0.28	0.24		-2.53	-3.02		-0.49

Table 2. Calculations of Amplitude and Phase shift in Fig. 2.

Rev-erbα	1.07	1.03	0.546124065	-5.67	-5.07	2.83676E-05	0.60	0.57033
	1.14	1.10		-5.63	-5.06		0.57
	1.21	1.17		-5.58	-5.04		0.54
Rev-erbβ	0.40	0.66	0.095649589	-3.07	-3.42	0.00041534	-0.35	-0.394
	0.45	0.58		-3.01	-3.41		-0.40
	0.52	0.51		-2.95	-3.38		-0.43
Rorα	0.18	0.14	0.025304057	-1.43	-1.99	0.080165343	-0.56	-0.3733
	0.19	0.15		-1.32	-1.53		-0.21
	0.20	0.16		-1.22	-1.57		-0.35
Dbp	0.79	0.86	6.39516E-05	-3.34	-3.69	0.007052032	-0.35	-0.3243
	0.78	0.87		-3.20	-3.52		-0.33
	0.78	0.87		-3.26	-3.56		-0.30

Table 3. Calculations of Amplitude and Phase shift in Fig. 3.

Gene name	Amplitude		p value for Amplitude	Phaseshift		p value for Phaseshift	ΔPhase (NaBr vs. NaCl)	ΔPhase Average
Gene name	NaCl	NaBr	p value for Amplitude	NaCl	NaBr	p value for Phaseshift	ΔPhase (NaBr vs. NaCl)	ΔPhase Average
Hk2	0.29	0.46	0.437642813	-3.45	-5.99	0.000233689	-2.54	-2.3397
	0.29	0.21		-3.54	-5.44		-1.90
	0.30	0.42		-3.23	-5.81		-2.58
Pkm2	0.27	0.52	0.617244481	-0.34	-2.17	0.013337489	-1.83	-1.4984
	0.45	0.25		-0.79	-1.92		-1.12
	0.26	0.36		0.15	-1.40		-1.54
Pparα	0.19	0.11	0.004450818	0.19	1.00	0.017072428	0.81	1.05276
	0.16	0.12		0.17	0.93		0.76
	0.19	0.13		0.17	1.76		1.59

Table 4. Calculations of Amplitude and Phase shift in Fig. 4.

Gene name	Amplitude		p value for Amplitude	Phaseshift		p value for Phaseshift	Δphase (NaBr vs. NaCl)	Δphase Average
Gene name	NaCl	NaBr	p value for Amplitude	NaCl	NaBr	p value for Phaseshift	Δphase (NaBr vs. NaCl)	Δphase Average
Ulk1	0.19	0.24	0.03049082	-4.35	-5.48	0.007565867	-1.13	-1.0143
	0.10	0.31		-4.09	-5.11		-1.02
	0.08	0.23		-3.99	-4.88		-0.89
Gabarapl1	0.11	0.16	0.212811981	-9.08	-7.12	0.008738159	1.97	1.60033
	0.12	0.19		-8.29	-7.08		1.21
	0.13	0.12		-8.19	-6.56		1.63
Atg5	0.23	0.18	0.01075632	2.81	7.08	0.0011111	4.27	5.04133
	0.24	0.17		3.31	8.51		5.20
	0.24	0.13		3.35	9.00		5.65

sFig. 1 Bromide does not affect survival and apoptosis of rat neonatal primary cardiomyocytes. Rat neonatal primary cardiomyocytes were treated with NaBr at indicated doses for 24 h. (a) Cell viability was assessed by CCK-8 assay.

sFig. 2 Bromide regulates clock gene expression in H9C2 cardiomyocytes. H9C2 cardiomyocytes were incubated with NaBr at indicated doses for 24 h. (a) RT-qPCR analysis of the mRNA expression levels of Clock, Per1, Per2, Cry1, Rev-erbα, Rev-erbβ and Dbp. *p<0.05 and **p<0.01 vs. NaCl group. n=3. All the data were represented as the mean ± SD.

sFig. 3 QX77 partially reversed the inhibitory effect of NaBr on the mRNA and protein expression levels of clock genes and glycolytic genes. H9C2 cardiomyocytes were treated with 400μM NaBr in combination with or without 10μM QX77 for 24 h. (a) RT-qPCR analysis of the mRNA expression levels of Bmal1, Cry1 and Rorα. (b) RT-qPCR analysis of mRNA expression levels of Hk2, Pkm2 and Pparα. (c) Western blot analysis of protein expression levels of BMAL1, CRY1, RORα, PKM2 and HK2. (d) Densitometric determinations of BMAL1, CRY1, RORα, (e) HK2 and PKM2. *p<0.05 and **p<0.01 vs. NaCl group, ^#p<0.05 and ^##p<0.01 vs. NaBr group. n=3. All the data were represented as the mean ± SD.

sFig. 4 H9C2 cardiomyocytes were susceptible to H₂O₂ stimuli after treatment of NaBr. H9C2 cardiomyocytes were treated with NaBr with or without 1μM H₂O₂ for 24 h. Cell viability was assessed by CCK-8 assay. **p<0.01 vs. NaCl group, ^##p<0.01 vs. NaCl plus H₂O₂ group. n=3. All the data were represented as the mean ± SD.

PDF

Journal Publication

published 19 Jun, 2020

Read the published version in BMC Molecular and Cell Biology →

Review #1 received at journal
21 Apr, 2020
Reviewer #1 agreed at journal
07 Apr, 2020
Reviewers invited by journal
07 Apr, 2020
Editor assigned by journal
06 Apr, 2020
Submission checks completed at journal
05 Apr, 2020
Editor invited by journal
05 Apr, 2020

You are reading this latest preprint version

Bromide impairs the circadian clock and glycolytic homeostasis via disruption of autophagy in rat H9C2 cardiomyocytes

Status:

Journal Publication

Version 2

Abstract

Figures

Background

Results

Discussion

Conclusion

Methods

Abbreviations

Declarations

References

Tables

Supplementary Figure Legends

Supplementary Files

Status:

Journal Publication

Version 2