Strains and Clinical samples
T. gondii tachyzoites (RH strain), preserved at our laboratory, were aseptically cultured in vitro, by serial passages in Vero cells, as previously described [26]. A total of 267 blood samples from patients clinically at the First Affiliated Hospital of Wannan Medical College were collected between December 2018 to November 2020. The blood samples were divided in two aliquots and placed in the anticoagulant tubes (containing 10µL 0.5µmol /L EDTA) and non-anticoagulant tubes, respectively. The blood in the non-anticoagulant tubes was centrifuged and the serum was aseptically separated for serology with electrochemiluminescence (ECL) assay (Roche, Switzerland). Blood from anticoagulant tubes is used to extract genomic DNA.
DNA extraction
A DNeasy Blood & Tissue Kit (Tiangen Biotech Beijing Co., Ltd., China) was used, to extract genomic DNA from blood samples under the the manufacturer’s instructions. All these DNA samples were stored at -20℃ until subsequent analysis. Due to the suspected low amount of circulating DNA in these blood samples whose status infection was unknown, each sample was divided into three parts and repeated eluted in order to improve DNA yield and detection rate. Each repliate was then tested and a positive result for any of the sections indicated that the sample was positive.
Construction of standard recombinant plasmids
Previous studies have reported the 529bp repeated element (GenBank AF146527) as the potential optimal targets for T. gondii [27]. The 529bp repeated element is a recently discovered target gene, with up to 300 copies, which offers more sensitivity and specificity during detection [27]. PCR products of T. gondii 529bp fragment were amplified in the positive tachyzoites of T. gondii, and electrophoresed, excised, purified, and cloned into the pMD™19-T vector (Takara). The positive clones were sequenced directionally (ABI 3730). The positive recombinant plasmids of T. gondii are kept in our laboratory (Wannan Medical College, China). It is the recombinant plasmids used as standard nucleic acids were quantified with a NanoDrop ND1000 spectrophotometer. Then the recombinant plasmids were prepared with a dilution range 1 ng/µL-1×10− 9 ng/µL as a standard control and stored at -20℃ until needed.
Design of primer and crRNA probe
Since success of RAA amplification depends on designing the ideal primers for target the gene, we employed the online primer designing software and designed 5 pairs of specific oligonucleotide primers targeting the 529bp repeated element of T. gondii. The primers annealing temperature are 54–67℃ with the length about 30-35bp, and the amplicon size is (100-300bp) (Table 1). Specific crRNA probes were designed target the specific primer sequence fragment (Table 1). The DNA probes were prepared into RNA by in vitro transcription, according to the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, America). There should be paid to the 5' end accessory T7 RNA polymerase promoter sequence during probe design. The transcript (crRNA probe) was purified using RNAXP magnetic beads and the concentration of the product was determined by Qbuit nucleic acid concentration detector (Thermo, America). All primers were synthesized by TsingKe Biotech (Beijing TsingKe Biotechnology, Beijing, China).
Table 1
Primer sequence for RAA-Cas13a-LFD assay.
Primer
|
Sequence(5'to3')
|
Amplicon sizes (bp)
|
Description
|
TOX-F1
|
ACTACAGACGCGATGCCGCTCCTCC
|
283
|
Candidates for RAA primers that were screened in
this study. TOX-F1/TOX-R1 pair was used for follow-up experiment experiments
|
TOX-R1
|
TGTCTCCCTCGCCCTCTTCTCCACT
|
|
TOX-F2
|
ACACCGGAATGCGATCCAGACGAGA
|
126
|
TOX-R2
|
GTCCAAGCCTCCGACTCTGTCTCCC
|
|
TOX-F3
|
ATATCAGGACTGTAGATGAAGGCGAGGGT
|
176
|
TOX-R3
|
CGTCTCGTCTGGATCGCATTCCGGTGTCT
|
|
TOX-F4
|
TAGATGAAGGCGAGGGTGAGGATGAGGGG
|
121
|
TOX-R4
|
CTCCAGGAAAAGCAGCCAAGCCGGAAACA
|
|
TOX-F5
|
AAGATGTTTCCGGCTTGGCTGCTTTTCCTG
|
162
|
TOX-R5
|
CCGACTCTGTCTCCCTCGCCCTCTTCTCCA
|
|
T7 promoter
|
GAAATTAATACGACTCACTATAGGG
|
|
Promote the transcription of amplified DNA to RNA in vitro transcription.
|
Probe1
|
CGUCUCGUCUGGAUCGCAUUCCGGUGUC
|
|
Expected sequences of guide RNA obtained from in vitro transcription. Probe1 was used for follow-up experiment experiments.
|
Probe-2-5-a
|
UUCUCUCCGCCAUCACCACGAGGAAAGC
|
|
Probe-2-5-b
|
CAAUUCUCUCCGCCAUCACCACGAGGAA
|
|
Probe-3-4-a
|
CUCCGACUCUCGUCGCUUCCCAACCACG
|
|
Probe-3-4-b
|
CCGACUCUCGUCGCUUCCCAACCACGCC
|
|
Lateral flow reporter
|
FAM/mArArUrGrGrCmAmArArUrGrGrCmA/Bio
|
|
Trans cleavage reporter for Cas13a
|
Establishment of RAA assay
The basic RAA reactions were achieved by the Basic RAA kits (Anhui Microanaly Genetech, Hefei, China). The reaction buffer was premixed according to the following formula: 25µL of rehydration buffer, upstream primers (10µmol/L) 2µL, downstream primers (10µmol/L) 2µL, 25×SYBR Green Ⅰ 1µL, recombinant plasmids (1ng/µL) 2µL, MgOAc solution (280nmol/L) 2.5µL, and 17.5µL of nuclease-free water. The aforementioned reaction tube was put into fluorescent quantitative PCR instrument to amplify for 40min at 37℃. The amplified products were analyzed Qsep100 biological analyzer (BIOptic, Taiwan) by collecting the fluorescence.
Establishment of RAA-Cas13a-LFD assay
Here, targeted detection was used gene editing technology based on nucleic acid amplification and Cas13a-mediated collateral cleavage of a reporter RNA, allowing for real-time detection of the target. The 529bp target gene of T. gondii was amplified by RAA, T7 RNA polymerase transcription of amplified DNA to RNA and detection of target RNA by Cas13a collateral RNA cleavage mediated release of reporter signal. The fluorescence reporter signal can be detected by LFD, LFD is an endpoint assay, with lateral flow strips exposed to the reaction mixture post incubation (Fig. 1).
The RAA-Cas13a-LFD reaction formula was as the following: LwCas13a nuclease (45nmol/L) (Anhui Microanaly Genetech, Hefei, China)), Lateral flow reporter molecule (125nmol/L) (Integrated DNA Technologies, Iowa, USA), RNase inhibitor (1µL) (New England Biolabs, America), ATP (1mM), GTP (1mM), UTP (1mM), CTP (1mM) and T7 polymerase (0.6µL) were mixed to the total system 8µL. Then, 1µL crRNA probe (30ng/µL) and 1µL of RAA products were added into 8µL of aforementioned mixture and mixed thoroughly. It is recommended to incubation at 37℃ for 40 minutes. Add 20µL diluent buffer to the 10µL of the reaction and mix well. The lateral-flow dipsticks were insert into the mixture for 3–5 minutes. and results were recorded until the positive control line was visualized.
Results explanation of RAA-Cas13a-LFD assay
Cas13a detection was adapted for lateral flow detection (LFD), with an important alteration: the Lateral flow reporter was replaced with FAM-ssRNA-Biotin reporter (FB reporter) [28, 29]. Without trans cleavage, the FB reporter will remain intact and its biotinylated end can be captured by streptavidin at the control line. Anti-FAM antibody conjugated to gold nanoparticles can then bind the exposed FAM moiety, resulting in the color deposit on the control line. It was negative if only control line (red band) appeared, indicating that there is not the amplification fragment of the target gene in the sample (Fig. 2). On the other hand, if the FB reporter has undergone trans cleavage by Cas13a, a portion of reporter molecules will contain biotin, but not FAM. As a result, fewer FAM ends will be present at the control line, and a higher amount of antibody-conjugated gold nanoparticles will be able to travel further to deposit on the test line. It was positive when test line and control line both appeared or only test line red band appears, indicating that the target gene of T. gondii to be detected in the sample.
Evaluation of RAA-Cas13a-LFD specificity and sensitivity
In order to determine the analytical specificity of the RAA-Cas13a-LFD assay developed in this study, the nucleic acids of human blood, Ascaris lumbricoides, Digramma interrupta, Entamoeba coli, Fasciola gigantica, Plasmodium vivax, Schistosoma japonicum, Taenia solium and Trichinella spiralis were used as templates for the RAA reactions. The sensitivity of the RAA-Cas13a-LFD assay was assessed using 10-fold serial dilutions of the recombinant plasmids ranging from 1 ng/µL-1×10− 9 ng/µL. All experiments were carried out in duplicate, and the recombinant plasmid was the positive control and ddH2O was the negative control. Different RAA products were directly analyzed by lateral-flow dipsticks.
To verify the analytical specificity and sensitivity of the RAA-Cas13a-LFD assay developed in this study, a real-time PCR (qPCR) also performed using the forward primer, reverse primer, and probe primer target the the same 529bp gene. The sequence of forward primer, reverse primer, and probe primer are AGACGAGACGACGCTTTCC, GCATCTGGATTCCTCTCCTACC, and CGTCCAAGCCTCCGACTCTGTCTC, respectivly. qPCR reactions were performed in 20 µL reaction volumes, comprising 10µL 2×Master Mix (Roche, Switzerland), 10µM of each forward and reverse primers, 10µM of probe primer, and 2µL of the template. Amplification was performed as follows: initial denaturation at 95℃ for 30s; followed by 40 cycles of denaturation at 95℃ for 10 s, primer annealing at 60℃ for 30s; dissociation at 95℃ for 15s, 60℃ for 60s, and 95℃ for 15s. The products of qPCR were visualized according to amplification curve generated by the LightCycler 96 qPCR instrument (Roche, Switzerland).
Application of the RAA-Cas13a-LFD assay for clinical samples
We tested the established RAA-Cas13a-LFD method for detection of T. gondii in blood samples collected from patients of Clinical Laboratory. A total of 267 blood samples were simultaneously tested with serology ECL assay, qPCR and the RAA-Cas13a-LFD assay for detection of T. gondii. To evaluate the validity of establishment RAA-Cas13a-LFD assay, blood samples were all to amplify the 529 gene for detection of T. gondii by qPCR assay.