In silico analysis of bulk and single transcriptome of MCHR1, MRAP1 and MRAP2 expression
Human bulk RNA sequencing data were downloaded from The Genotype‐Tissue Expression (GTEx) project (https://www.gtexportal.org/) and mouse RNA sequencing datasets were downloaded from all RNA‐seq and ChIP‐seq sample and signature search (ARCHS4) database (https://amp.pharm.mssm.edu/archs4/). Datasets of mouse cerebric and hypothalamic single-cell RNA-seq were GSE74672, GSE87544, GSE130597 and GSE125065, which are downloaded from Gene Expression Omnibus (GEO) DataSets.
For bulk RNA sequencing data analysis, Fragments Per Kilobase per Million mapped fragments (FPKM) was utilized to normalize the expression level of each mRNA transcript. Next, we respectively analyzed the samples of whole brain and hypothalamus from humans and mice. We calculated Pearson’s correlation coefficient between MCHR1 and MRAP1 or MRAP2 expression value across all samples. For single cell RNA-seq analysis, all datasets were filtered and excluded low-quality cells that had unique feature counts less than 200. The co-expression of cell number between MRAP2 and MCHR1 positive neuronal populations were calculated. Next, Pearson’s correlation coefficient was calculated between the expression value of MRAP2 and MCHR1 across all cells.
To calculate the changes in MRAP2 and MCHR1 expression under high-fat diet condition, we counted the proportion of cells expressing this gene in the expression profiles of high-fat diet and normal diet respectively. And tested the significance of the differences using fisher's exact test. In order to explore the pathways in which these genes are involved, we did GO pathway enrichment analysis using clusterProfiler R package.
Reagents, plasmids, and antibodies
MCHR1, MRAP1 and MRAP2 were alll amplified from wild type BL/C57 mice cDNA. All PCR products were ligated into pcDNA3.1(+) vector and the constructs were all verified by sanger sequencing. Melanin concentrating hormone (MCH) was purchased from BACHEM. SNAP-94847 (MCHR1 antagonist) was purchased from MCE. In this study, anti-mouse HA monoclonal antibody (Sigma-Aldrich, MO, USA), Anti-mouse Flag monoclonal antibody (ABclonal Biotech Co., Ltd, Wuhan, China), Anti-mouse IgG antibody (ABclonal Biotech Co., Ltd, Wuhan, China) and HRP-conjugated antibodies against mouse (ABclonal Biotech Co., Ltd, Wuhan, China) were used.
Cell culture and transfection
HEK293T cells were cultured in DMEM medium (high glucose) supplied with 10% FBS and 1% penicillin–streptomycin (P/S). And cells were incubated in 37 °C cell incubator consisting of 5% CO2. Transfection was conducted using P-PEI reagent according to the manufacturer’s protocols. The total transfected amount of plasmids was kept identical in each group by adding empty pcDNA3.1 vector.
Tissue expression analysis
RT-PCR in this study was performed as previously described (Agulleiro et al., 2010). Briefly, cDNA was synthesized by extracting RNA from 14 mouse tissues (heart, liver, spleen, lung, stomach, pancreas, fat, kidney, brain, cerebellum, eye, thorax, spinal cord and genital gland). All PCR products were separated on 1.5% agarose gel and β-actin as internal control was also carried out. Primers used in this study were all synthesized from GENEWIZ and the primer sequences of mMCHR1, mMRAP1, mMRAP2 and mβ-actin are listed as below. mMCHR1_fw: ATCACTGCTGCGTACGTGAA; mMCHR1_rev: TCACCCTCTTTGTCCGAAGC; mMRAP1_fw: CTGAAAGCCAACAAGCATTCCA; mMRAP1_rev: CCGACCAGGACATGTAGAGC; mβ-actin _fw: GCCTTCCTTCTTGGGTATGGA; mβ-actin_rev: ACGGATGTCAACGTCACACT.
Western blot and co-immunoprecipitation
Proteins were extracted 24-36 h after transfection and then incubated with mouse anti-HA or mouse anti-Flag antibody at 1:5000 dilution overnight at 4 °C. Next day, protein A+G beads (Beyotime, Shanghai, China) were added and rotated at 4 °C for 4 h. Finally, beads were re-suspended in protein loading buffer after 3 washes and boiled for 15 min. Samples were run on 12% SDS-PAGE gels and mouse anti-FLAG antibody was used for detecting MRAP1/MRAP2 in MCHR1 co-immunoprecipitation experiments. Images were captured by ImageQuant 4000.
Bimolecular Fluorescence Complementation Assay (BiFC) and co-immunofluorescence
HEK293T cells seeded on poly-L-lysine pretreated coverslips and transfected with MCHR1-F1 and MRAP1-Flag-F2 or MRAP2-Flag-F2. The next day, cells were fixed with 4% PFA Fix Solution for 20 minutes. Cells were incubated with anti-FLAG antibody (Cell Signaling) at 1:5000 for 2 h at room temperature to detect MRAP1 and MRAP2. Then washed 3 times and incubated with 1:5000 secondary antibody Alexa Fluor594 (Abcam) for 2 h at room temperature. To detect membrane translocation of MCHR1 in presence of MRAP2, we transfected GFP-MCHR1 and MRAP2 or RAMP3 in a ratio of 1: 9 into cell, with no antibody treated. In order to observe co-fluorescence of MCHR1 and MRAP2 chimeras, 3HA-MCHR1 and each 2xFLAG MRAP2 chimera were transfected transiently into cells. Cells were incubated with both anti-HA and anti-FLAG antibody (Cell Signaling) at 1:5000 for 2 h at room temperature. Then washed 3 times and incubated with both 1:5000 secondary antibody Alexa Fluor488 (Abcam) and Alexa Fluor594 (Abcam) for 2 h at room temperature.
Coverslips were fixed with nail polish on the glass slide containing ProLong (R) Gold Antifade with DAPI Molecular Probes (Cell Signaling). Imaging was performed using a 63X oil objective with laser-scanning Zeiss confocal microscopy (LSM880).
Enzyme-linked immunosorbent assay (ELISA)
HEK293T cells were seeded in 12-well plates and transfected with MCHR1 and MRAP2 (1:0 to 1:9 ratio receptor to MRAP2). Upon 24-36h transfection, ELISA were performed as previous described (Jones et al., 2007). Cells were fixed 20 min with 4% PFA after 3 washes and then blocked with 5% milk in PBS for 30 min at room temperature. Next, cells were incubated with mouse anti-HA monoclonal antibodies (1:2000) for 2h, following HRP-conjugated secondary antibodies against mouse (1:2000) incubation for 2h at room temperature. After incubating with TMB solution for 15 min, the reaction was stopped with 5% sulfuric acid. And the absorbance was read at 450 nm on Spectramax M5 multimode plate reader.
Ca2+ luminescent assay
HEK293T cells were cultured in 24-well plates and different MRAP2 mutants were co-transfected along with MCHR1, NFAT (firefly luciferase) and pRL-TK (renilla luciferase) reporter vectors into HEK293T cells via P-PEI according to the manufacturer’s instructions. After 24-36h transfection, old medium was removed and different concentrations of MCH (from to M) in DMEM supplemented with 0.1% BSA were added in cell and incubated for 9h at 37°. For competitive inhibition test, concentration of SNAP-94847 (MCHR1 antagonist) ranged from to M was added in HEK293T cells supplemented with 2 × M (EC80) MCH.
Dual-luciferase reporter gene assays in this study were conducted using Dual-Glo kits (Promega, WI, USA) according to the manufacturer’s instructions. Luciferase activities were tested by Spectramax M5 multimode plate reader. Firefly luciferase values were normalized to Renilla luciferase values for relative quantification.
Sequence homology comparison
DNAMAN software was utilized to compare the amino acid sequence similarity of human and mouse MRAP2. Distinct colors highlighted the similarity score of various amino acids, in which the Red represented 100% consistency between sequences; blue indicated the amino acids at this position were not conserved, which got a similarity score between 0 to 33.
Statistic analysis
All experiments in this study were repeated at least three times. Data were analyzed by the Graphpad Prism6 software. Pharmacological curves were carried out by the log(agonist) vs. response equation (Y = Bottom+(Top-Bottom)/(1+10^((LogEC50–X)))) (X: log(agonist); Y: response values) method. One-way ANOVA with Tukey post-test were applied to measure significance between groups and results were shown as mean ± SEM. The tests were performed with a nominal significant level of *p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001.