Construction of recombinant plasmids
First, DNA coding sequences of the DNA polymerase from Thermus aquaticus (GenBank: P19821.1) and of CL7, which is a mutant of CE7 from E. coli (GenBank: CP018986.1) were obtained [11]. The two fragments were synthesized by GeneCreate (Wuhan, China). The designed primers for amplification are listed in Table 1. The gene synthesis procedure was performed as described previously. PCR amplification was then used to obtain two products: the Taq DNA polymerase gene (2493 bp) and the CL7 gene (390 bp). The pET-30 vector was digested with the restriction endonuclease Xba I (Takara, Shiga, Japan), and the product was purified using the DNA Gel Extraction Kit (Promega, Madison, WI, USA). Then the PCR products were mixed together with the digested pET-30 vector. Finally, T5 cloning (New England Biolabs, Ipswich, MA, USA) was performed, in which CL7 was fused to the N-terminus of Taq DNA polymerase with the 7-amino acid linker (ENLYFQG) and a 6 × His tag to the C-terminus. This was necessary for the purification of recombinant protein by metal affinity chromatography. Nucleotide sequences of the resulting recombinant plasmids, pET30/Taq and pET30/CL7-Taq, were confirmed by DNA sequencing (Sangon, Shanghai, China).
Table 1
Primers used in this study for PCR.
Primer | Sequence(5’-3’) |
Cl7-F | aagcaatgaaccgggtaaagcaaccggtg |
Cl7-Linker | accctgaaaatacaggttttcgcc |
Taq-Linker | aacctgtattttcagggtcgtggtatgctgccgct |
Taq-his | gtgatggtgatggtgatgttcttttgcagacagccagt |
Protein expression and purification
Plasmids encoding Taq and CL7-Taq were used to transform the E. coli BL21 strain (DE3). Luria-Bertani (LB) medium was prepared. E. coli containing recombinant plasmid were grown to an A600 of 0.6 in LB containing 50 µg/mL kanamycin at 37 °C. Then isopropyl-β-D-1-thiogalactopyranoside (IPTG) was added at a final concentration of 1 mg/ml to induce Taq or CL7-Taq expression from the T7 promoter with shaking at 18 °C. After 12 h incubation, the cells were centrifuged at 7,000 × g for 5 min, and the pellets were resuspended in 20 mL of lysis buffer (20 mM Tris-HCl [pH 9.0], 0.5 M NaCl, and 10 mM imidazole). Protein complexes were extracted by ultrasonic decomposition and the insoluble debris was removed by centrifugation at 12,000 × g and 4 °C for 20 min.
For heat treatment, the cleared lysate was immersed in a 75 °C orbital water shaker for 30 min, cooled on ice for 20 min, and then the denatured host proteins were removed by centrifugation at 12,000 × g and 4 °C for 20 min. Following heat treatment, the exogenous proteins were purified in a one-step process using the Ni2+-affinity chromatographic technique. A His-bind resin and His-bind buffer kit (GE Life Sciences, Chicago, IL, USA) were used to purify the His-tagged proteins according to the manufacturer’s instructions. The supernatant and produced enzyme were put into a column containing Ni-nitrilotriacetic acid (Ni-NTA) agarose (GE Life Sciences), which was previously prepared and equilibrated with lysis buffer. After binding to the Ni-NTA agarose column, the recombinant proteins were washed twice with washing buffer (20 mM Tris-HCl [pH 9.0], 0.5 M NaCl, and 50 mM imidazole), and then eluted with elution buffer (20 mM Tris-HCl [pH 9.0], 0.5 M NaCl, and 200 mM imidazole). An equal volume of each buffer (20 µL) was loaded onto a 12% (w/v) polyacrylamide gel for SDS-PAGE [12], followed by staining with Coomassie Brilliant Blue G-250. Finally, the eluted fractions were dialyzed three times with storage buffer (20 mM Tris-HCl [pH 8.0], 100 mM KCl, and 0.2 mM EDTA). Protein concentrations were measured using the Bradford method.
DNA polymerase activity assay
The DNA polymerase activity of purified proteins was assayed using the EvaEZ Fluorometric Polymerase Activity Assay Kit (Biotium, Hayward, CA, USA). All assays were conducted in an isothermal reaction at 60 °C using a CFX Real-Time PCR instrument (Bio-Rad, Hercules, CA, USA) in accordance with the definition of one unit of enzyme activity (“One unit of DNA polymerase activity is usually defined as the amount of enzyme that will produce 10 nmol of nucleotides during a 30-min incubation”). Enzymatic activity was determined relative to a commercial Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA) with an activity of 1 U/µL. When the DNA polymerase was active, the primer was extended to form a double-stranded product that bound the EvaGreen dye, resulting in increased fluorescence. The rate of increase is positively correlated with polymerase activity [13].
Optimization of PCR amplification
To optimize the amplification process, polymerase activity was measured using various concentrations of MgCl2, KCl, and (NH4)2SO4 in the buffer as well as various pHs. All PCR reactions were performed using 1 mM of each dNTP, 0.4 mM of each primer and of the pET30a-GFP plasmid DNA as template, containing a known target sequence (PCR product of 445 bp). PCR assays were performed using 1 U of purified CL7-Taq or Taq DNA polymerase in a 20 µL reaction mixture containing 1 ng of DNA template. The PCR conditions were as follows: 3 min at 95 °C, and then 25 cycles of 15 s at 95 °C, 15 s at 60 °C, and 30 s at 72 °C. To determine the optimum MgCl2 concentration, PCR was performed at various pHs (7.0–9.0) with the use of the Tris–HCl buffer. Then, we used the Tris-HCl buffer (pH 8.0) containing increasing concentrations of MgCl2 (0–9 mM) to detect the enzyme activity. Furthermore, PCR was performed with various concentrations of KCl (10–90 mM) and (NH4)2SO4 (10–90 mM).
Temperature stability was also assayed [14]. One unit of purified CL7-Taq and Taq DNA polymerases were heated at 99 °C for 10, 20, 30, 40, 50, and 60 min, and at 95 °C for 1, 2, 3, 4, and 5 h. Then, the same amount of enzyme was used to amplify a 445-bp target fragment under the optimal reaction buffer (in the same PCR conditions determined in the optimization process): 20 mM Tris-HCl (pH 8.0), 3 mM MgCl2, 10 mM (NH4)2SO4, and 20 mM KCl.
Measuring the PCR amplification rate
PCR amplification rates were measured using the protocol described by [15] CL7-Taq and Taq DNA polymerases were used to amplify PCR products of 1, 2, 3, and 4 kb under the conditions determined in the optimization process and using pET23a/dcas9 plasmid DNA as a template, which was recombined in our laboratory. PCR amplification started with an initial denaturation at 95 °C for 3 min and included 25 cycles of 30 s at 95 °C, 30 s at 60 °C, and 60 s at 72 °C.
Sensitivity
Following sufficient modifications, DNA polymerase sensitivity (affinity for template) was measured using the protocol by [16]. PCR was conducted under conditions optimized for the fusion polymerases CL7-Taq and Taq. We used pET23a-GFP Plasmid as a template along with the primers 5ʹ-TGGTCTTCAATGCTTTGCGAGATAA-3ʹ (forward) and 5ʹ-CTTTTCGTTGGGATCTTTCG-3ʹ (reverse). The product of the reaction was 445 bp. The reaction was conducted at decreasing template concentrations (serial 10-fold dilutions of the template) and included an initial denaturation at 95 °C for 3 min followed by 35 cycles of 30 s at 95 °C, 30 s at 60 °C, and 90 s at 72 °C. The amplified fragments were analyzed in a 1.5% agarose gel stained with ethidium bromide.
Resistance to inhibitors
The effect of PCR inhibitors such as heparin (Sigma-Aldrich, St. Louis, MO, USA) at a range from 16 to 1 µg, lactoferrin (Sigma-Aldrich) at a range from 4 to 0.5 µg, and blood at a range from 8–1%, on the catalytic activity of the CL7-Taq and Taq DNA polymerases was assessed by a PCR reaction using human genomic DNA as a template and the specific β-actin primers 5ʹ-AGAGATGGCCACGGCTGCTT-3ʹ (forward) and 5ʹ-ATTTGCGGTGGACGATGGAG-3ʹ (reverse) [16]. The amplified fragments were analyzed in a 1.5% agarose gel stained with ethidium bromide.