2.1 Reagents
Chemical reagents AS-IV (#HY-N0431), SB225002 (#HY-16711) and AMD3100 (#HY-10046) were purchased from MedChemExpress (Monmouth Junction, NJ, USA), and PF573228 (#T2001) was purchased from TargetMol (Boston, MA, USA). According to the instructions, dry powders of AS-IV, SB225002 and PF573228 were dissolved and diluted with dimethyl sulfoxide (DMSO), and dry powders of AMD3100 were dissolved and diluted with ethanol.
2.2 Isolation of ADSCs
Human adipose tissue was obtained from the subcutaneous fat of the upper arm and abdomen of a 30-year-old healthy female donor (the First Affiliated Hospital of Xi'an Jiaotong University, China) through liposuction. To extract ADSCs, adipose tissue was cut into small pieces, placed in a centrifuge tube, rinsed with phosphate buffered saline (PBS) and centrifuged (1000 rpm, 5 min). The lower liquid was aspirated, the adipose tissue was digested at 37°C for 40 minutes using a digestion solution containing 0.2% collagenase I (#SCR103, Sigma–Aldrich, St Louis, MO, USA), and the centrifuge tube was shaken several times during digestion. Then, an equal volume of DMEM/F-12 medium containing 10% fetal bovine serum was added for neutralization, pipetted for 5 minutes and centrifuged (1500 rpm, 10 minutes). After centrifugation, the lowermost cell-containing mixed liquid was aspirated and centrifuged twice (1000 rpm, 5 min). Culture medium was added to resuspend the cells, filtered with a 200-mesh cell strainer, and inoculated into a 60 mm cell culture dish. The medium was changed every other day until the cells reached 80–90% confluence. The cells can be harvested for expansion and cryopreservation.
2.3 Cell culture
HUVECs were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA), and the cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Gemini, Woodland, CA, USA) and 1% antibiotic-antimycotic (HyClone, Logan, UT, USA). ADSCs were cultured in Dulbecco's modified Eagle's medium F-12 (DMEM/F-12) (Gibco) supplemented with 10% fetal bovine serum and 1% antibiotic-antimycotic. Cells were incubated at 37°C in a 5% CO2 humidified incubator. ADSCs used in this study were less than 6 passages (P6).
2.4 Flow cytometry
Trypsin (HyClone) digested the cells and resuspended with PBS to a concentration of 1×106 cells/100 µl. The samples were mixed with anti-human CD29-FITC (#11–0299–41, eBioscience, San Diego, CA, USA), CD44-PE (#12–0441–81, eBioscience), CD90-FITC (#11–0909–41, eBioscience), CD105-APC (#17–1057–41, eBioscience), CD34 (#17–0349–41, eBioscience), CD45-PE (#12–0456–41, eBioscience). Five microliters of antibody solution was added into 100 µL PBS with cell suspension and incubated in the dark at 4°C for 30 minutes. Finally, a FACSCalibur™ flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) was used to analyze the stained cells. FlowJo 10 (BD Biosciences) software was used to analyze the data. The experiment was repeated three times.
2.5 MTT assay
ADSCs in logarithmic growth phase were treated with the indicated treatment method, and then the cell viability was detected by 3-(4,5-dimethylthiazole-2-yl) -2,5-diphenyltetrazolium bromide (MTT) (Sigma–Aldrich). ADSCs were suspended at a concentration of 3×104 cells/ml and seeded in a 96-well plate at 200 µl per well. After incubating for a specific time in the cell culture incubator, add 20 µl of MTT was added to 180 µl of complete medium per well. After four hours, the liquid was removed from the 96-well plate, 150 µl of DMSO was added, and the plate was shaken for 10 minutes. The absorbance was measured at 490 nm by an ELISA reader (Bio–Rad, Hercules, CA, USA). The experiment was repeated three times.
2.6 Preparation of conditioned medium
A total of 5×105 cells were inoculated into a 10 cm cell culture dish and grown in DMEM/F-12 supplemented with 10% fetal bovine serum and 1% antibiotic-antimycotic and different concentrations of AS-IV for 48 hours until the cells reached approximately 80% confluence. Then, the medium was replaced with FBS-free medium and incubated for 48 h. Then, the medium was collected and centrifuged, conditioned medium (CM) was obtained and used for this study. For the inhibitor group, we added an appropriate concentration of inhibitor 1 hour before adding AS-IV, and the subsequent treatment was the same as described above.
2.7 Wound healing assay
ADSCs or HUVECs were inoculated in 6-well plates and grown to a 90% fusion rate. Wounds were generated on the cell monolayer using a 200 µl sterile pipette tip, and the fragments were washed with PBS and replaced with FBS free medium or different groups of CM. The migration of cells to the wound was observed by inverted microscopy at different time points. Under the condition of 100 times magnification, regions were randomly selected in each well, and the cells in each group of 3 wells were quantified in each experiment.
2.8 Transwell migration assay
Migration assays were performed in a Boyden chamber (Millipore, Darmstadt, Germany) with a pore size of 8 µm to evaluate the migration ability of ADSCs and the recruitment of HUVECs. For migration assays, 1.5×104 ADSCs were seeded into a chamber in a 24-well plate, the cells were suspended in 100 µl serum-free medium in the upper chamber, and 600 µl medium containing 10% FBS was added to the lower chamber. For recruiting assays, 1.5×104 HUVECs were inoculated in the upper chamber, and different groups of CM were added to the lower chamber. After 24 hours, the chamber was washed with PBS 3 times, fixed with 4% paraformaldehyde for 15 minutes, and stained with 0.1% crystal violet for 15 minutes. Then, the upper part of the filter was wiped and inverted under a light microscope (200 times magnification) to observe the visible cell count in 3 random visual fields. The experiment was repeated three times.
2.9 qRT–PCR
According to the manufacturer's instructions, total RNA was isolated from ADSCs cells using RNAfast 200 reagents (Feijie Biotechnology, Shanghai, China), quantified by absorbance at 260 nm and reverse-transcribed to complementary DNA using a Prime Script RT–PCR kit (Takara Bio, Dalian, China). cDNA was amplified to detect the expression of specific genes using a CFX96 Real-Time PCR system (Bio–Rad) with SYBR-Green PCR Master Mix (Takara Bio). Gene-specific primers were as follows: CXCR2, F: CCTGTCTTACTTTTCCGAAGGAC and R: TTGCTGTATTGTTGCCCATGT; CXCR4, F: ACTACACCGAGGAAATGGGCT and R CCCACAATGCCAGTTAAGAAGA, bFGF, F: AGAAGAGCGACCCTCACATCA and R: CGGTTAGCACACACTCCTTTG; VEGF, F: AGGGCAGAATCATCACGAAGT and R: AGGGTCTCGATTGGATGGCA; GAPDH, F: GGAGCGAGATCCCTCCAAAAT and R: GGCTGTTGTCATACTTCTCATGG. Gene mRNA expression levels were assessed by the 2−ΔΔCt method. GAPDH was used for standardization.
2.10 Western blot assay
After treatment under various experimental conditions, ADSCs ware washed 3 times with PBS, and the total protein was separated with RIPA lysis buffer (Beyotime, Shanghai, China) containing protease inhibitor, phosphatase inhibitor and 0.1 M PMSF (Beyotime). Cells were centrifuged at 12,000 g at 4°C for 20 minutes, and cell lysates containing total cell proteins were collected and quantified by the BCA method (Thermo Fisher Scientific, Waltham, MA, USA). The processed protein samples were subjected to SDS-polyacrylamide gel electrophoresis (8–12%), and then transferred to a polyvinylidene fluoride (PVDF) membrane. After sealing with 5% skim milk at room temperature for 1 hour to block the nonspecific binding sites, the membrane was incubated with the primary antibody (diluted 1:1000) at 4°C overnight. After washing with TBST 3 times, the membrane and peroxidase-coupled secondary antibody were incubated at room temperature for 1 hour. Finally, protein expression was detected by an ECL chemiluminescence detection system (Bio–Rad). The antibodies used in the experiment were as follows: CXCR2(#ab225732), CXCR4(#ab181020), p-PXN(Y118)(#ab109547),t-PXN(#ab32084) were purchased from Abcam (Cambridge, United Kingdom)༌p-FAK(Tyr397)(#8556), t-FAK(#3285) and β-Catenin(#8480) were purchased from Cell Signaling Technology (Boston, MA, USA).
2.11 Matrigel tube formation assay
Fifty microliters of basement membrane matrix gel (Matrigel) (BD Biosciences) was spread on the bottom of a 96-well plate at 4°C, and placed at 37°C until Matrigel solidified. HUVECs were suspended at a concentration of 1.5×104 cells per 150 µL in each kind of CM and inoculated onto a previous Matrigel-coated 96-well plate. After 4 hours of incubation, the field of view was randomly photographed, and the number of lumens formed by each sample and the length of the tube were measured with ImageJ software (National Institutes of Health, Bethesda, MD, USA). The experiment was repeated three times.
2.12 Matrigel plug in vivo assay
All male C57BL/6 mice used in this study were approved by the ethics committee of the First Affiliated Hospital of Xi'an Jiaotong University, China. To assess the in vivo angiogenic potential of cells, Matrigel plug assays were performed as described in previous literature [18]. Briefly, 6- to 8-week-old C57BL/6 mice were anesthetized with isoflurane, 5×104 ADSCs were suspended in 50 µL PBS and mixed with 450 µL Matrigel, and the cells were subcutaneously transplanted into mice. After 2 weeks, the mice were euthanized, and Matrigel plugs were collected. Half of each plug was used for section staining, and the other half was used to measure the level of hemoglobin by the Drabkin kit (Sigma–Aldrich). The experiment was repeated 3 times.
2.13 Ischemic hind limb mice model and cell injection
An ischemic hindlimb module was induced as described in previous literature [19]. Each male C57BL/6 mouse aged 6–8 weeks was anesthetized with isoflurane and its left femoral artery was ligated and resected. A total of 1×106 cells were intramuscularly transplanted into the ischemic hindlimb area after surgery (n = 6). A laser Doppler perfusion imager (Moor Instrements, Devon, United Kingdom) was used to measure blood perfusion in the hind limbs at 0, 3, 7, 14 and 21 days after the operation. The left-to-right ratio (L/R) was used to indicate the relative blood perfusion rate of each mouse's left hind limb. The mice were euthanized 4 weeks after the operation, and their left gastrocnemius muscle was collected to make paraffin-embedded sections for immunohistochemistry and immunofluorescence analysis.
2.14 H&E Staining
Formalin-fixed Matrigel plugs or gastrocnemius specimens were embedded in paraffin. The slides are prepared from 6µm thick sections. For histological analysis, hematoxylin (Sigma–Aldrich) and eosin (Sigma–Aldrich) staining were applied. The experiment was repeated three times.
2.15 Immunofluorescence staining
The slices were dewaxed and rehydrated. Endogenous peroxidase was inactivated with 10% hydrogen peroxide for 10 minutes. The antigen was recovered by pepsin at 37°C for 10 minutes. The sections were blocked in 5% BSA for 30 minutes and then mixed with 1:500 CD31 antibody (#ab28364; Abcam) and incubated at room temperature for 1 hour. After washing, the slices were incubated with the secondary antibody for 1 hour at room temperature, and the nuclei were stained with DAPI (Sigma–Aldrich) for 5 minutes and sealed with glycerol. The stained image was captured under a positive fluorescence microscope (Olympus, Tokyo, Japan), and the proportion of CD31 + area in each photo was measured by ImageJ software. The experiment was repeated three times.
2.16 Statistical analyses
Statistical analyses were conducted using Student's t-test for comparisons of 2 groups, and graphs were drawn by using GraphPad Prism 7.0 (San Diego, CA, USA). The data are expressed as the mean ± SD of three independent experiments. P < 0.05 indicated statistically significant.