Goat mammary epithelial cell isolation and culture
Goat mammary gland tissues were surgically isolated from a 2-year-old lactating Guanzhong dairy goat at 36 d of lactation as described previously [22], which were reared in Shaanxi Province (P. R. China). The mammary parenchyma was obtained under sterile conditions, placed in sterilized PBS with penicillin, streptomycin, and amphotericin B at 100 U/mL, 100 µg/mL, and 25 ng/mL (Sigma, St. Louis, MO, USA), and immediately transported to the laboratory. Tissue pieces were finely minced and put into a 24-well culture plates, one piece for each hole, and cultured in Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12; BasalMedia, Shanghai, China) containing 10% KnockOut Serum Replacement (SR; Gibco, Waltham, MA, USA) and 10 ng/mL epidermal growth factor (EGF; Sigma). The medium was replaced every 3 d, until cells had spread across the bottom of the plate. All cells were cultured in a 37°C incubator with 5% CO2.
Cell lines and cell culture
The HEK-293T cells was purchased from the Institute of Biochemistry and Cell Biology (Chinese Academy of Sciences, Shanghai, China), and were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco) prior to further treatment. All cells were cultured in a 37°C incubator with 5% CO2.
Construction and identification of shGPR30 lentiviral vectors
To knockdown the expression of GPR30 gene (GenBank: XM_018039918), short hairpin RNAs against GPR30 (shGPR30) and negative control (shRNA) were designed by online software (https://rnaidesigner.invitrogen.com/rnaiexpress/), and synthesized by Sangon Biotech (Shanghai) Co., Ltd. All sequences are as described in Table 1. The method of constructing short hairpin RNA lentivirus vectors was performed as previous description [23]. After detecting by ampicillin (Solarbio, Beijing, China), drug-resistant colonies were delivered to be analyzed by Sangon Biotech (Shanghai) Co., Ltd. For knockdown of the target GPR30, synthesized vectors and packaging vectors were transfected into HEK-293T cells using TurboFect Transfection Reagent (Thermo Fisher Scientific, Waltham, MA, USA) to form lentivirus. GMECs were incubated with lentivirus of shGPR30 and shRNA for 18 h before removing. After transfection, cells were allowed to grow, and then gained for protein extraction. Western blot analysis was used to evaluate the knock-down efficiency of GPR30.
Table 1 Hairpin short interfering RNA (shRNA) inserts.
|
shRNA
|
Sequence (loop in bold letters) (5’-3’)
|
shGPR30-1
|
GATCCGCTCATCCTGGTGGTGAACATTTCAAGAGAATGTTCACCACCAGGATGAGCTTTTTTG
|
|
AATTCAAAAAAGCTCATCCTGGTGGTGAACATTCTCTTGAAATGTTCACCACCAGGATGAGCG
|
shGPR30-2
|
GATCCGCTCATCGAGGTGTTCAACCTTTCAAGAGAAGGTTGAACACCTCGATGAGCTTTTTTG
|
|
AATTCAAAAAAGCTCATCGAGGTGTTCAACCTTCTCTTGAAAGGTTGAACACCTCGATGAGCG
|
shRNA
|
GATCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTTG
|
|
AATTCAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAAG
|
Abbreviations: shGPR30, short hairpin G protein-coupled receptor 30; shRNA, short hairpin negative
|
Immunofluorescence
The GMECs were seeded in 24-well culture plates (1 × 104 cells/well) and allowed to grow for 6 d. After this, cells were washed 3 times with PBS for 5 min each time, and fixed for 30 min using 4% paraformaldehyde (Solarbio) at room temperature. All fixed cells were washed 3 times with PBS and incubated with a blocking buffer (1% FBS in PBS) for 2 h at room temperature. Subsequently, cells were incubated with primary antibody against cytokeratin 18 (CK18; ab668, abcam, Cambridge, MA, USA) and GPR30 (ab39742, abcam) overnight at 4°C. The nuclei were stained with Hoechst 33342 (Sigma) in dark for 5 min at room temperature. Images were captured using a fluorescence microscope (Olympus, Tokyo, Japan).
Cell cycle analysis
Flow cytometry analysis was used to measure cell cycle distribution. GMECs were cultured in 6-well culture plates at a density of 1.5 × 105 cells/well and allowed to grow for 4 d. Then, cells were cultured with estrogen (Sigma), G1 (Cayman Chemical Co, Ann Arbor, MI, USA), and estrogen + G15 (Cayman Chemical Co) for 48 h. Subsequently, cells were harvested with 0.25% (w/v) trypsin, fixed in 70% ice-cold ethanol overnight at 4°C, incubated with RNase A (20 µg/mL; CWbio, Jiangsu, China) for 30 min, and stained with 50 µg/mL of propidium iodide (Sigma) in dark for 20 min at room temperature. The cell cycle data were assayed using the flow cytometer (BD Biosciences, San Jose, CA), and analyzed by the Modfit software (Tree Star, Inc., Ashland, OR).
Cell counting assay
Cell proliferation was tested by cell counting. Briefly, 1 × 104 cells/well were seeded in 24-well plates for 24 h, and then cultured with estrogen (Sigma), G1 (Cayman Chemical Co), and estrogen + G15 (Cayman Chemical Co) for 5 d. Next, cells were harvested with 0.25% (w/v) trypsin and resuspended in fresh medium. Cell numbers were determined using a hemocytometer, and proliferation was expressed as population doubling time (TD). TD = t × log 2 / (log Nt - log N0), where t is the culturing time; N0 is the initial cell numbers; Nt is the cell numbers after culturing time.
Cell viability assay
Cell viability was evaluated using the Cell Counting Kit-8 kit (BOSTER, Wuhan, China). In detail, 6 × 103 cells/well were seeded in 96-well plates for 24 h and then cultured with estrogen (Sigma), G1 (Cayman Chemical Co), and estrogen + G15 (Cayman Chemical Co) for 5 d. Next, CCK-8 solution (10 µL/well) was added and incubated for 2 h, and the absorbance value was measured at 450 nm.
Bromodeoxyuridine labeling and immunofluorescence assay
Cell proliferation was detected using the BrdU assay. Briefly, GMECs were seeded in 24-well culture plates at a density of 1 × 104 cells/well and allowed to grow for 4 d. Next, cells were cultured with estrogen (Sigma), G1 (Cayman Chemical Co), and estrogen + G15 (Cayman Chemical Co) for 48 h and were then cocultured with bromodeoxyuridine (BrdU; 10 µM; Sigma,) for 2 h in a 37°C incubator with 5% CO2. Next, cells were fixed in 4% paraformaldehyde (Solarbio) for 30 min, permeabilized with 0.2% TritonX-100 (Sigma) for 15 min, treated with 1 M HCl for 15 min, incubated with an anti-BrdU antibody (SAB4700630, Sigma) overnight at 4°C. The nuclei were counterstained by Hoechst 33342 (Sigma) in dark for 5 min at room temperature. BrdU positive cells were observed and counted through an inverted fluorescence microscope (Olympus)
Western blot
Western blot was implemented to test the phosphorylation and total levels of Erk1/2 and Akt as well as the expression of cell cycle checkpoint regulators including cyclin D1, cyclin B1, CDK1, and p-CDK1 in GMECs. Total cellular and cytoplasmic proteins were lysed with High-efficiency RIPA buffer (Solarbio) including protease and phosphatase inhibitors and applied to SDS-PAGE with equal amounts of protein. After separation, protein was transferred to a polyvinylidene difluoride membrane (PVDF; Millipore, MA, USA). Following transfer, the membranes were blocked with 3% BSA (Solarbio) diluted in Tris buffer saline containing 0.1% tween (TBST) for 2 h at room temperature. Then, membranes were incubated overnight at 4°C with the specific primary antibodies against GPR30 (ab39742, abcom), β-casein (sc-166530, Santa Cruz Biotechnology, Santa Cruz, CA, USA), Erk1/2 (4695, Cell Signaling Technology, Beverly, MA, USA), p-Erk1/2 (4370, Cell Signaling Technology), Akt (BM4390, BOSTER), p-Akt (BM4390, BOSTER), cyclin D1 (D160236, Sangon Biotech), cyclin B1 (4135, Cell Signaling Technology), CDK1 (77055, Cell Signaling Technology), p-CDK1 (4539, Cell Signaling Technology), and β-actin (4970, Cell Signaling Technology). Membranes were washed 3 times and incubated with the corresponding horseradish peroxidase conjugated secondary antibodies overnight at 4°C. Finally, the protein bands were detected with a chemiluminescence kit (Biotanon, Shanghai, China).
Statistical analysis
The data were presented as average values ± standard error of the means from 3 independent experiments of cell counting assay, cell viability assay, BrdU assay, and Western blot analysis. Statistical analyses were performed with SPSS (version 20.0; SPSS Inc., Chicago, IL, USA), which were checked using Tukey’s test. Probability (p) value < 0.05 was considered statistically significant.