2.1. Reagents
Premix Ex TaqTM, puc57 vector, Top10 competent cells and a small amount of plasmid extraction kit were purchased from Takara, Japan. Genomic DNA extraction kit and gel recovery kit were purchased from Beijing Tiangen Biochemical Technology Company. EZ DNA Methylation-Gold™ Kit was purchased from ZYMO Research, USA.
2.2. Patients and samples
This study collected the bone marrow samples of 81 patients with AML and CML who were admitted to the outpatient and inpatient departments of Yantai Yuhuangding Hospital affiliated to Qingdao University from September 2020 to January 2021. Among these 81 patients, 41 patients were diagnosed as AML and 40 patients were diagnosed as CML (Supplementary Table 1). All patients were diagnosed by cytomorphology, cytogenetics and molecular genetic analysis of bone marrow samples, and were classified according to the revised 2008 World Health Organization (WHO) standards. This study was approved by the Ethics Committee of Yantai Yuhuangding Hospital affiliated to Qingdao University. All participants provided signed informed consent.
2.3. Construction of reference materials
According to the PER2 sequence retrieved by GenBank, a CpG-rich region in the promoter region of the PER2 gene was selected as the original template sequence. According to the rule of DNA modification by bisulfite, the methylated and unmethylated bisulfite modified DNA sequences were designed as the positive (MSP-5) and negative (MSP-6) reference materials. The two sequences were linked with pUC57 vector respectively, and then transformed into Escherichia coli Top10 competent cells. After oscillating culture at 37 ℃ for 1 h, they were coated on AMP + AGAR plate to screen positive clones and expand the culture. The bacteria liquid PCR identification of MSP-5 and MSP-6 was performed with methylated primers and non-methylated primers respectively. Primer sequences were presented in Supplementary Table 2[29]. The positive recombinant plasmid was extracted and sent to Shanghai ShengGong Biological Company for sequencing, and the sequence was compared and analyzed by BLAST on NCBI.
2.4. Conversion of plasmid copy number concentration
The recombinant plasmid obtained in the above operation was first used to measure the OD260/OD280 value and the concentration by Nanodrop Lite spectrophotometer. The concentration of plasmid DNA is 20 ng/uL. The calculation formula for converting plasmid concentration into copy number is: concentration of copy number (copies/µL) = [plasmid concentration(ng/µL) × 10-9)×(6.02×1023)] / (base number×660). According to this formula, the concentration of plasmid copy number was 6×109 copies/uL.
2.5. Primers and probe design
The specific primers and probe were designed based on the CpG distribution characteristics of MSP-5 and MSP-6, the distance between the upstream and downstream primers and the Tm value. The sequences of the primers and probes are shown in the Table 1. The 5’ end of the probe is labeled with FAM fluorophore and the 3’ end is labeled with BHQ1 fluorophore. All primers and probes are synthesized by Invitrogen.
Table 1
Primers and probe used for TaqMan real-time FQ-MSP
Primers and probe
|
Sequence(5’-3’)
|
Length(bp)
|
Tm
|
GC
|
Product length (bp)
|
MF5
|
TGCGGTTTCGTTGCGGTTTAC
|
21
|
62.56
|
52%
|
140
|
MR5
|
GCCGACGCCGTTTCAAACCG
|
20
|
65.37
|
65%
|
|
Probe
|
AAACCCGCGCGCCGACGACGA
|
21
|
|
|
|
2.6. TaqMan real-time FQ-MSP assay and standard curve
MSP-5 was continuously diluted by 10-fold ratio to different concentrations as a template for TaqMan real-time FQ-MSP. In order to determine the best reaction system and reaction conditions of the TaqMan real-time FQ-MSP assay, different concentrations of primers and probe were used in the experiment (primers concentration: 100nM~400nM, probe concentration: 200nM~500nM) (Supplementary Fig. 1, Supplementary Fig. 2), and annealing temperature is gradually increased from 55°C to 65°C to screen out the best primers and probe concentration and the best annealing temperature, so that it has better amplification efficiency. In the experiment, each concentration was measured 3 times. Then, according to the established optimal reaction system and reaction conditions, perform TaqMan real-time FQ-MSP reaction on the gradiently diluted MSP-5. Finally, we analyze the data results and draw a standard curve. The Y-axis of standard curve represents the number of cycles experienced by the sample's fluorescence signal reaching the set threshold (Ct value), and the X axis represents the logarithm of the DNA copy number.
2.7. Analytical specificity, analytical sensitivity, accuracy, reproducibility
Analytical specificity
The optimized system and reaction conditions were used to perform TaqMan real-time FQ-MSP on MSP-5 and MSP-6, to see if there was specific amplification, so as to evaluate the specificity of TaqMan real-time FQ-MSP assay.
Analytical sensitivity
According to the optimal reaction system and reaction conditions, perform 20 times of TaqMan real-time FQ-MSP on the 10-fold dilution of MSP-5. According to the MIQE guidelines, We consider the lowest concentration that can be detected in at least 95% of the samples in the test results as the minimum detection limit[30]. At the same time, conventional MSP assay and real-time fluorescence quantitative PCR(SYBR GREEN) assay(qPCR) were used to amplify the same template. MSP-6 was set as a negative control in each experiment. Finally, the minimum detection limit of the three methods was determined, and then the detection results of the various methods were compared to evaluate the sensitivity of the methods.
Accuracy
Choose plasmids with a concentration of 6 to 6×107 copies/uL higher than the minimum detection limit, perform 10 detections on each concentration sample with the method established in this study. According to the number of positive results detected, the accuracy of the method is evaluated. Reproducibility
Four positive standards in different concentrations (6×107 copies/uL, 6×105 copies/uL, 6×103 copies/uL, and 6×10 copies/uL) were used as templates for TaqMan real-time FQ-MSP assay. The intra-batch reproducibility experiment is to do 10 repetitions of the template in one TaqMan real-time FQ-MSP assay. The inter-batch reproducibility experiment is to measure the same template 10 times in 10 days. Finally, the obtained test results are analyzed to obtain SD and CV, so as to evaluate the reproducibility of the method.
2.8. DNA extraction, bisulfite modification
Genomic DNA extraction kit was used to extract genomic DNA from the collected bone marrow samples, and the absorbance value was detected with Nanodrop Lite spectrophotometer to determine the DNA concentration and purity. Subsequently, Zymo Research's EZ DNA Methylation-Gold™ Kit was used for bisulfite conversion of DNA and stored DNA at -20°C.
2.9. TaqMan real-time FQ-MSP assay and conventional MSP assay
In order to assess and compare the detection effect of TaqMan real-time FQ-MSP assay and conventional MSP assay, these two assays were used to detect the PER2 methylation level of 81 leukemia patients from the Yantai Yuhuangding Hospital affiliated to Qingdao University. MSP-6 was set up in each experiment as a negative control, and a blank control is also set up. After that, the clinical samples with inconsistent detection results between the TaqMan real-time FQ-MSP assay and conventional MSP assay were sent to Shanghai Shenggong Biological Company for pyrophosphate methylation sequencing to verify the accuracy of the assay.