Clinical samples and DNA extraction
Histopathology reports consistent with aspergillosis or mucormycosis issued between January 2006 and January 2016, and relevant FFPE blocks were retrieved from the Department of Pathology at a tertiary referral hospital in South Korea. Ethics approval was obtained from the hospital’s institutional review board (Yonsei University Health System, Severance Hospital, Institutional Review Board, IRB trial number: 4-2016-0262). Pan-fungal PCR assays were performed on these FFPE blocks to determine the presence of Aspergillus species and mucorales. Samples testing positive for A. fumigatus by DNA sequencing were subjected to L98H, M220, and TR46 PCR assays and consecutive DNA sequence analysis to determine the presence of azole-resistance mutations in the A. fumigatus cyp51A gene.
FFPE tissues were deparaffinized with mineral oil, and DNA was extracted with proteinase K using the ReliaPrep™ FFPE gDNA Miniprep System (Promega, Madison, WI, USA), according to the manufacturer’s instructions. Agarose gel electrophoresis and PCR methods were used to assess DNA degradation.
Primers for PCR assays of Aspergillus species and Mucormycosis identification
Pan-fungal PCR was performed to amplify internal transcribed spacer (ITS) regions. The primers ITS5 (forward; 5’GGAAGTAAAAGTCGTAACG-3’) and ITS4 (reverse; 5’- TCCTCCGCTTATTGATATGC - 3’) were used to amplify ITS 1 to ITS 2 regions (ITS 1-2), and the primers ITS3 (forward; 5’- GCATCGATGAAGAACGCAGC -3’) and ITS4 (reverse; 5’- TCCTCCGCTTATTGATATGC - 3’) were used to amplify the ITS 2 region. [12] The ITS 1-2 and ITS 2 PCR products so obtained were of 640 and 350 base pairs (bp), respectively. (supplementary table 1)
Primers for PCR assays of cyp51A gene mutations
To amplify L98H, M220, and TR46 mutation in the cyp51A gene, we used a previously described nested, one-step PCR assay. [28] Three different primer sets were used to amplify these three mutations. To amplify L98H, we used 5’- AAAAAACCACAGTCTACCTGG - 3’ (forward), and 5’- GGAATTGGGACAATCATACAC - 3’ (reverse) to generate a 143 bp PCR fragment. [29] For M220, we used 5’- GCCAGGAAGTTCGTTCCAA - 3’ (forward) and 5’- CTGATTGATGATGTCAACGTA - 3’ (reverse) to generate a 173 bp PCR fragment. [29] Nested PCR assay was performed to amplify TR46 in the promoter region of cyp51A; one primer pair was used to amplify a long DNA fragment and a second primer pair was used to amplify an inner shorter fragment in a second PCR step. For the first step, the PCR primer pairs were 5’ - AAGCACTCTGAATAATTTACA - 3’ (forward) and 5’ - ACCAATATAGGTTCATAGGT - 3’ (reverse) to obtain a 240 bp DNA fragment, and in the second step, 5’ - GAGTGAATAATCGCAGCACC - 3’ (forward) and 5’ - CTGGAACTACACCTTAGTAATT - 3’ (reverse) were used to generate a 103 bp DNA fragment. [28] (supplementary table 2)
PCR assays and controls
To amplify ITS regions, PCR was performed in total volumes of 50 μl, consisting of 1X reaction buffer, 0.1 μM dNTPmix, 1.25 U of Taq DNA Polymerase (RBC Bioscience, Xindian City, Taiwan), 20 pmol of each primer, and 200 ng of DNA (1 μL) per sample. PCR was performed using the following protocol; 95°C for 3 minutes, 35 amplification cycles of 94°C for 30 seconds, 50°C for 1 minute, and 72°C for 1 minute, and a final extension at 72°C for 7 minutes.
To detect L98H and M220 alterations, PCR was conducted in a total volume of 50 μl containing 2 μl template DNA (100 ng human DNA + unknown amount of A. fumigatus DNA), 1X reaction buffer, 0.1 μM dNTPmix, 1.25 U of Taq DNA Polymerase (RBC Bioscience, Xindian City, Taiwan), and 20 pmol of each primer. The PCR amplification protocol was as follows; 5 min of initial denaturation at 94°C, 39 amplification cycles of 94°C for 45 s, 52°C for 1 min, and 72°C for 1 min, and final extension at 72°C for 10 min.
To detect TR46 alterations, PCR was conducted in a total volume of 50 µl as described for L98H and M220 above. The PCR amplification protocol was as follows; 5 min denaturation at 94°C, 22 amplification cycles of 94°C for 45 s, 52°C for 1 min, and 72°C for 1 min, and final extension at 72°C for 5 min. For the second PCR step, we used a total volume of 50 μl and 3 μl of the first-step PCR mixture as template. Other components were as described for L98H and M220. The second step PCR amplification protocol was as follows; 5 min initial denaturation at 94°C, 34 amplification cycles of 94°C for 45s, 56°C for 1 min, and 72°C for 1 min, and final extension at 72°C for 5 min.
To exclude cross-reactivity of the primers with human genomic DNA, samples containing a mixture of 100 ng of human DNA and 50 pg of A. fumigatus wild-type DNA were used as a negative control. An azole-resistant A. fumigatus strain (GenBank accession no. AF338659) harboring the TR34/L98H/S297T/ F495L mutation in the cyp51A gene was used as a positive control for detection of the L98H mutation.[30]
Sequence analysis
To identify Aspergillus species and mucorales, PCR products were purified using the MiniElute PCR purification kit (Qiagen, Hilden, Germany). A minimum of 50 ng DNA was sequenced using the BigDye Terminator version 3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA) and an Applied Biosystems 3730XL DNA Analyzer (Applied Biosystems, Foster City, CA). Sequences were edited and aligned using Sequence Scanner Software 2 ver. 2.0 (Applied Biosystems, Foster City, CA), and product sequences were compared with reference sequences using the NCBI alignment service AlignSequenNucleotideBlast (http://www.ncbi.nlm.nih.gov/). The GenBank accession number for the A. fumigatus sequences determined in this study is CM000169.1.
To detect potential mutations in the PCR products subjected to DNA sequence analysis, sequences were compared with the A. fumigatus cyp51A wild-type sequence using the NCBI alignment service AlignSequenceNucleotideBlast (http://www.ncbi.nlm.nih.gov/).