Cell culture and inhibitor treatments
Human melanoma A375 cells were purchased from Bioresource Collection and Research Center (BCRC; Hsinchu, Taiwan) with authentication. Adherent culture was maintained using culture dish (Corning Incorporated Life Sciences, Tewksbury, Massachusetts, USA) and DMEM medium supplemented with 10% (v/v) fetal bovine serum (Biological Industries Ltd., Cromwell, Connecticut, USA). Suspended melanoma cells were established and cultured by impaired attachment of adherent melanoma cells accordingly24,25. In general, 4x105 cells were cultured at sterile plastic dishes (Alpha-plus Inc., Taiwan) for 3 days before experiments. This generated the suspended melanoma cells.
Oligomycin (mitochondrial ATP synthase inhibitor), 2-deoxyglucose (2DG; glycolysis inhibitor), Trifluoromethoxy carbonylcyanide phenylhydrazone (FCCP; oxidative phosphorylation uncoupler), Rotenone and antimycin A (electron transport chain complex inhibitors) were all purchased from Sigma (Sigma-Aldrich China, Inc., Shanghai, PR China).
Cell proliferation or cell viability assay
For cell proliferation under different glucose concentrations, 4x105 cells were seeded at culture dish or sterile plastic dishes with indicated glucose concentration. Cells were incubated in humidified CO2 incubator for 3 days. The cells were collected and the total cell numbers were counted by trypan blue methods.
For cell viability assay, it was assayed by alamar blue method (Thermo Fisher Scientific Inc., Pittsburgh, PA, USA). In general, 1x104 cells were seeded in each well of 96-well plate (Corning Incorporated Life Sciences, Tewksbury, Massachusetts, USA) pre-coated with or without polyHEMA. After overnight incubation, inhibitors were added and incubated for 1 days in culture incubators before the assays.
Flow cytometry assay.
For DNA content analysis by flow cytometry, the adherent and suspended cells were maintained at adherent or suspended condition respectively with indicated serum concentration for 3 days. The cells were then harvested by trypsinization, ethanol-fixed, and performed the propidium iodide staining in the standard procedure. The labeled cells were analyzed by Partec flow cytometer ML (Partec North America, Inc., NJ, USA).
Lactate release assay and ROS detection assay
Quantification of lactate level was done using Lactate Colorimetric Assay Kit (Biovision, Inc., Milpitas, California, USA) according to vendor’s protocol. Adherent or suspended cells (2x105 cells) were incubated in the culture medium at pH7.0 or pH8.5 for 1 days without pH adjustment by CO2. The condition medium was collected and centrifuged for the following assay.
Detection of ROS levels in melanoma cells was done using ROS Detection Cell-Based Assay Kit (Cayman Chemical Co., Ann Arbor, Michigan, USA) according to vender’s protocol. Dihydroethidium is the redox-sensitive fluorescent probe. Its oxidation into 2-hydroxyethidium by superoxide or other ROS causes the increased fluorescence intensity at 600nM or 576nm. Antimycin A treatment and N-acetylcysteine treatment were positive and negative controls of ROS production, and used to calculate the relative percentage of ROS production.
Polymerase chain reactions and statistical analysis
The levels of mRNA in cultured cells were analyzed by qPCR. The cDNAs were synthesized by MMLV HP reverse transcriptase (Epicentre Inc., Madison, Wisconsin, USA) using freshly prepared RNA as PCR template. Quantitative real-time PCR was performed using Fast Quant Green Master Mix with ROX (Protech Technology Enterprise Co., Ltd., NanKung, Taipei, TAIWAN) in a StepOne Plus real-time PCR system (Thermo Fisher Scientific Inc., Pittsburgh, Pennsylvania, USA). The 2− ΔΔCT method was used to determine the relative gene expression using GAPDH as control. The p-value of < 0.05 or < 0.01 was statistically significant and was indicated in figures. The forward and reverse primers used were: MCT1 (SLC16A1), gtggctcagctccgtattgt and gagccgacctaaaagtggtg; MCT2 (SLC16A7), caacaccattccaagacagc and tggctgttatgtacgcagga; MCT4 (SLC16A3), cagttcgaggtgctcatgg and atgtagacgtgggtcgcat; GLUT1 (SLC2A1), ttgcaggcttctccaactggac and cagaaccaggagcacagtgaag; GAPDH, gagtcaacggatttggtcgt and gatctcgctcctggaagatg.
Western blot and antibodies
To harvest cell lysate for western blot analysis, cells were washed and disrupted by lysis buffer (10 mM Tris-HCl, 5 mM EDTA, pH 8.0, 1% TritonX-100, and protease inhibitors) and kept on ice for 30 min. The lysate was then centrifuged at maximum speed using a desktop centrifuge at 4oC for 15 min. Protein concentrations were quantified by protein assay kit (Bio-Rad Laboratories Inc., Hercules, California, USA).
Western blot was performed according to standard protocol. Briefly, the protein mixture was subjected to SDS-PAGE and transferred onto a PVDF membrane followed by blocking with 5% (w/v) skim-milk. The membrane was then incubated in primary antibodies (1:1000 in 5% skim-milk in TBST) overnight at 4 oC, and HRP-conjugated secondary antibody (1:20000) for 1 hr at room temperature followed by enhanced chemiluminescent (Millipore Co., Massachusetts, USA) detection. The primary antibody against MCT1 (SLC16A1), MCT2 (SLC16A7), MCT4 (SLC16A3), GLUT1 (SLC2A1) and β-actin were all purchased from GeneTex Inc., Hsinchu, Taiwan.
Metabolism stress tests using Seahorse XF24 analyzer
The mitochondrial oxygen consumption rate (OCR) and the extracellular acidification rate (ECAR) were measured using a Seahorse Bioscience XF24 extracellular flux analyzer (Agilent Technologies, Inc., Santa Clara, California, USA).
To prepare adherent melanoma cells, 5x104 cells were seeded at Seahorse cell culture microplate for overnight and reached 100% confluency on the next day. To prepare suspended melanoma cells, 5x104 suspended cells were seeded on the experiment day at microplate precoated with poly-L-lysine. The sensor cartridge with the utility plate was assembled and incubated in the non-CO2 incubator at 37° C overnight before the assays.
For mitochondria stress test to measure OCR, culture medium was replaced and incubated with glucose-free/ serum-free/bicarbonate-free medium (D5030; Sigma-Aldrich China, Inc., Shanghai, PR China) for 1 hr before the assays. Mitochondria stress profiles were monitored after the successive injection of oligomycin (2 µM), FCCP (carbonyl cyanide p-trifluoromethoxyphenylhydrazone, 1 µM), and rotenone/antimycin A (1 µM each) to the indicated wells. Glycolysis stress profiles were monitored after the successive injection of glucose (10 mM), oligomycin (2 µM), and 2-deoxyglucose (2DG, 50 mM). OCR and ECAR results were analyzed using the Seahorse XF-24 software. Every point represents an average of three different wells. The cell numbers in each wells were counted after the experiments, that were used to normalize the ECAR and OCR.