In vitro cytotoxicity evaluation of Cur-GNPs
Synthesized and characterized gold nanoparticles (GNP) coated with Cur (Cur-GNPs) [25] were generously gifted by Seyed Mohammad amini (Radiation Biology Research Center, Iran University of Medical Sciences, Tehran, Iran).
The colon carcinoma (HT-29) cell line was purchased from National Bank of Pasteur Institute (Iran) and cultured in RPMI-1640 cell growth medium supplemented with penicillin (100U/ml), streptomycin (100μg/ml), and 10% FBS. A standard humidified atmosphere (95% air & 5% CO2 at 37 °C) was provided for continuous cell culture.
In order to evaluate Cur-GNPs cytotoxicity, 104 cells/well HT-29 cells were seeded into each well of a 96-well plate. After 24h, culture medium containing a known concentration of Cur-GNPs was added and were incubated for an additional 24h. Using the same procedure, Cur dark cytotoxicity was examined by 1h incubation. For photodynamic studies, we added fresh culture medium containing Cur-GNPs (128mg/ml) and Cur (6.4μg/ml) to cells, and they were incubated for 1h. Then, the culture medium was replaced and exposed to the 150mW (15.7mW/cm2) laser (Thor International Ltd, Amersham, Bucks, UK) for 2 minutes. The real-time PCR and MTT tests were completed after 24 h incubation.
In vitro treatment with hyperthermia, PDT and combination treatment
The cell lines was cultured in RPMI-1640 supplemented with 10% of fetal bovine serum (FBS) (Gibco, USA) and incubated at 37 °C in 5% CO2. The medium was replaced every 2 days until the cells reached 80-90% confluence. The cells were incubated in culture medium supplemented with 10% FBS in an incubator preheated to 42 and 43 ˚C for 2 hours. Control groups were incubated at 37˚C for 2 hours, as well. After hyperthermia treatment, the cells were incubated at 37˚C for 2 hours prior to analysis.
For PDT treatment, first the cells were seeded in 96-well plates and incubated with 5 μM solution of Cur-GNPs for 24 h. Cur-GNPs culture medium was then removed and the plate was washed with 350 μL PBS per well. Irradiation was accomplished at room temperature with a LED-based illumination device (PDT EDL-1; Hamamatsu Photonics K.K., Hamamatsu, Japan). The expriments were adjusted by low-power laser (32 mW 630 nm diode laser, 0.5 J/cm2, continuous mode for 360 seconds). Following irradiation, fresh culture medium lacking phenol red was added, cells were incubated at 37 °C for 24 h. After the irradiation, cells were enriched by fresh medium and incubated for 24 h. Then, cell viability was evaluated by MTT assay.
For combination therapy with both hyperthermia and PDT, a cell group was simultaneously exposed to hyperthermia and PDT with the aforementioned conditions. In order to minimize interference with the optical sensitizer and maximize the effect of the laser, the cell culture medium was enriched with low FBS (% 1). The preheated cells at 42 and 43 ˚C for 2 hours, were cultured in the presence of Cur-GNPs and treated with low-power laser. Appropriate control groups were used in all experiments. The cells with no treatment were considered as control. Then, MTT test was performed to evaluate cell viability.
Cell morphology
To evaluate the effect of the hyperthermia and PDT on the cellular phenotype, the cells were evaluated using an inverted microscope.
Cell viability assay
After treatments, the cell viability was determined by MTT [3-(4, 5-dimethylthiazol-2-Yl)-2, 5-diphenyltetrazolium bromide] (BioIDEA,Iran) assay. For MTT assay, HT-29 cells were seeded in 96-well plates a day prior to the experiment. The cell viability was evaluated after hyperthermia exposure. Then, the culture medium was aspirated and 10µl MTT solution with a final concentration of 0.5 mg/mL was added. Afterward, 3 hours of incubation at 37°C, MTT solution was aspirated and 100µl well DMSO was added to each well. After 30 min incubation at 37 °C, the absorbance (570/630 nm) was measured using a microplate reader (BioTek, USA).
RNA extraction and cDNA synthesis
Total RNA was extracted from cells using high pure RNA isolation kit (Roche, Germany) according to the manufacturer’s instructions. The concentration of RNA was quantified using Nano Drop™ Lite Spectrophotometer (Thermo Fisher Scientific, USA). A 2% agarose gel electrophoresis was used to assess quality of RNA. Subsequently, cDNA was synthesized from the purified total RNA using a PrimeScript RT reagent Kit (Takara, Japan) according to the manufacturer's protocol.
Primers designed for quantitative Real-Time PCR
The GeneRunner softwarewas was used to design the primers for amplification of interested genes.Additionally, the primer specificity was confirmed by Primer-BLAST (www.ncbi.nlm.nih.gov/tools/primer-blast). The sequences of primers used in the current study are listed in Table 1. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as internal control for normalization (Table 1).
Table 1. Primers designed for amplification of interested genes.
DNA fragment name
|
Primer name
|
Primer sequence
|
Product length
|
OCT4
|
F
|
5´ CTTGAATCCCGAATGGAAAGGG 3´
|
164
|
R
|
5´ GTGTATATCCCAGGGTGATCCTC 3´
|
NANOG
|
F
|
5´ TTTGTGGGCCTGAAGAAAACT 3´
|
116
|
R
|
5´ AGGGCTGTCCTGAATAAGCAG 3´
|
GAPDH
|
F
|
5´ CACCAGGGCTGCTTTTAAC 3´
|
190
|
R
|
5´ ATCTCGCTCCTGGAAGAT 3´
|
Quantitative Real-Time PCR
To analyze mRNA levels, q-RT PCR was performed using SYBR® Premix Ex Taq™ II (Takara, Japan) and the ABI7500 system (Applied Biosystems; Thermo Fisher Scientific). The reaction system included 10 𝜇LSYBR_ Premix Ex Taq_II (2x), 0.4 𝜇L ROX dye, 2 𝜇L template cDNA, 0.4 𝜇L each primer, and 6.8 𝜇L RNase-free water. The q-RT PCR reactions were performed in the following cycling conditions: The initial denaturation step 95 ∘C for 30 sec, then 40 cycles of 95 ∘C for 5 sec and 60 ∘C for 30 sec. All experiments were repeated at least three times.
Statistical analysis
The SPSS 19.0 (SPSS, Inc., Chicago, IL, USA) software was used for statistical analysis. Kruskal Wallis test was used to compare the experiments. Gene expression data drived from real-time PCR were analyzed using GraphPad Prism 7.0 software. Data were presented as mean ± SEM. The p-values <0.05 were considered statistically significant.