Subjects
The study involved 38 clinic samples (6 initial T-ALL with translocation, 19 initial T-ALL with normal karyotype and 13 non-tumor samples were obtained from remission bone marrow aspirates with less than 1% leukemic cells as normal controls) from Xiangya Hospital of Central South University (Changsha, China) from June 2018 to May 2021. Meanwhile, another 12 age matched healthy volunteers who had physical examinations at the same hospital were recruited. All of the volunteers had no X-ray radiation, chemical poisons touch, smoking history and karyotype abnormalities. All participants signed informed consent forms before participating in the study, and the study was approved by the Ethics Committee of the Third Xiangya Hospital of Central South University. The accession number for this approval was Quick19159. The details of all patients are presented in Table S1. Overall, the gender, age, ethnicity, and occupations were similar between T-ALL and remission patients. No statistically significant differences were identified (date not shown).
Cells culture and treatments
Peripheral blood was collected from each healthy volunteer and treated with X-rays. 0.5 ml whole blood from each group was added into lymphocytes culture medium (Le Chen, Shanghai, China) at a humidified atmosphere of 37 ℃ and 5 % CO2 in air for 72 h. And the peripheral blood lymphocytes (PBLs) separated from the rest whole blood, were suspended in lymphocytes culture medium for further culturing. The lymphocyte cell lines AHH-1 were bought from ATCC (American Type Culture Collection, CRL-8146). The cell lines were cultured in RPMI 1640 (Thermo Fisher Scientific, USA) supplemented with 10% FBS (Thermo Fisher Scientific, USA). The cultures were incubated at 37˚C in a humidified atmosphere containing 5% CO2.
Bone marrow Karyotype
A standard 72 h lymphocyte culture of bone marrow (1-2 ml) from each patient performed to produce Metaphases for karyotyping. G banding was performed by a trypsin pretreatment of chromosomes followed by Giemsa staining. Chromosomes’ analysis was done using MetaSystems Ikaros (ZEISS, Germany) and karyotypes were reported according to International System for Human Cytogenetic Nomenclature [15]. Karyotype analysis was performed using at least 20 Metaphases for each sample. Number was expanded to 100 metaphases in case of suspected mosaicism.
RNA extraction, cDNA preparation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
Cellular RNAs were extracted using TRIZOL reagent (Takara Bio, Japan), according to the manufacturer's instructions. The RNA quality was assessed using a Nanodrop One (Thermo Fisher Scientific, USA) and agarose gel electrophoresis. cDNA was generated from 2 µg of total RNA using M‑MLV reverse transcriptase (Invitrogen, USA) with random primers. Quantitative PCR (qPCR) was performed on triplicate samples in a reaction mix of SYBR‑Green (Takara Bio, Japan) using the ABI 7500 Real‑Time PCR System (Applied Biosystems, USA). The conditions of PCR denaturation, annealing and extension were respectively 94˚C 30 sec, 37˚C 30 sec, and 72˚C 45 sec. Relative expression of Ku70 was normalized to GAPDH, and using the 2-ΔΔCq method [16]. The primers were synthesized by Sangon Biotech Co. Ltd. (Shanghai, China). Each RT‑qPCR reaction was performed in triplicate. The primer sequences were as follows: Ku70 forward, 5'-GGTTTCAAGCCGTTGGTACTGC-3' and reverse, 5'-CTCCAGACACTTGATGAGCAGAG-3'; GAPDH forward, 5’-ACCACAGTCCATGCCATCAC-3' and reverse, 5'-TCCACCACCCTGTTGCTGTA-3'.
Western blot analysis
Total protein from cells was acquired using lysis buffer (KeyGen Biotech, Nanjing, China). Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, USA) was used to calculate the protein concentration, 30μg of protein was loaded on an 8% SDS-PAGE gel at 80 V for 1.5 h and transferred to 0.45μm PVDF membranes (Millipore, USA). The membranes, blocked with TBS‑0.05% Tween 20 (TBST) containing 5% skimmed milk for 2 h at room temperature, were incubated with primary rabbit antibodies (Cell Signaling Technology, all diluted1:1,000) overnight at 4˚C and secondary HRP-conjugated goat anti‑rabbit antibody (Cell Signaling Technology, 1:5000 diluted) for 1 h at room temperature in sequence. The protein blots were then visualized using an ECL kit (Beyotime Institute of Biotechnology, China). Semi‑quantitative analysis of proteins was performed with Image Lab (Bio-Rad, USA). GAPDH was used as the loading control. Each western blot analysis experiment was repeated three times.
Ku70 interference and overexpression
Transfection was performed using Lipofectamine® 3000 transfection reagent (Thermo Fisher Scientific, USA) according to the manufacturer's instructions. AHH-1 cells were transfected with shRNA of Ku70 (Genebio, Shanghai, China), targeted with sequence AACCAAGACCCGGACCTTTAA (Ku70-shRNA) or scrambled shRNA (negative control) targeted with TTCTCCGAACGTGTCACGT following the manufacturer’s instructions to reduce the intracellular Ku70 levels, pcDNA3.1 or pcDNA3.1+Ku70 (Genebio, Shanghai, China) were transfected into cells to overexpress Ku70. Transfection effciency was assessed by western blotting after 72 h culturing. Cells were harvested and suspended in fresh lymphocytes culture medium, then irradiated by different dose X-rays, followed another 72 h culturing, the expression of Ku70, PARP1 and the frequency of chromosome translocations in the cells were respectively explored by western blot and fluorescence in situ hybridization.
Chemical inhibition
PARP1 inhibitor Olaparib (Abmole, USA) at 5 μM or 0.1% DMSO (solvent control) was added into the cells culture medium 3 h before X-rays. After 72 h culturing, the expression of Ku70, PARP1 and the frequency of chromosome translocations in cells were respectively explored by western blot and fluorescence in situ hybridization.
Fluorescence in situ hybridization (FISH)
FISH was used to detect the chromosome translocations in human PBLs and cell lines after X-rays as previously described [17]. Metaphases were harvested after co-cultured with colchicine for 2 h. Chromosomes 1 and 4 were painted green by in situ hybridization with composite probes labelled with SYBR green (Cytocell, UK), chromosomes 2 were painted red by in situ hybridization with composite probes labelled with Rhodamine B (Cytocell, UK). The observed frequency of translocations (Fp ) detected by FISH represents the frequency between painted chromosomes 1, 2 and 4 and the remaining counterstained chromosomes. To compare Fp with the values for translocations detected by the conventional method that detects aberrations involving the entire chromosome set, it is necessary to estimate the genome-equivalent frequency of translocations (FG ). Thus, since the fraction of the total genomic DNA content represented by painted chromosomes 1, 2 and 4 to the total genome is 0.228 for males and 0.224 for females, Fp was multiplied by 2.771 for males and 2.806 for females to estimate FG; the basic method used is essentially that described by Pearce et al [18]. 400 metaphase splitting images were observed for each sample by three observers. The experiments were repeated three times.
Comet assay (neutral condition)
The relative amount of DNA double-strand breaks (DSBs) was detected by neutral comet assay in PBLs as previously described [19]. Slides prepared were evaluated using a fluorescence microscope and the CASP software (CASP, Wroclaw, Poland). Data was expressed as tail intensity (% Tail DNA). The experiments were repeated three times.
Statistical analysis
Analysis was performed by GraphPad Prism 7.0 (GraphPad Software, San Diego, CA). Measurement data was expressed as the mean ± standard deviation (SD). Two group comparisons were analyzed by a two-tailed Student's t-test. One-way ANOVA and two-way ANOVA were used for multiple comparisons. P < 0.05 was considered to be statistically significant.