Strain and chemicals
P. pastoris X-33 strain (Invitrogen, Carlsbad, CA) was transformed with plasmid pPICZα A containing the lipase MAS1 gene. Lipase MAS1 gene expression was regulated by the AOX1 promoter [27, 28]. Yeast extract peptone dextrose (YPD) medium for seed culture contained (g/L) yeast extract 10.0, peptone 20.0 and glucose 20.0. The basal salt medium (BSM) for batch fermentation contained (g/L) glycerol 40, 85% H3PO4 26.7 mL, CaSO4 0.93, K2SO4 18.2, MgSO4·7H2O 14.9, KOH 4.13, PTM1 salt solution 4.35 mL. PTM1 salt solution contained (g/L) CuSO4·5H2O 6, NaI 0.08, MnSO4·4H2O 3, ZnSO4·7H2O 20, FeSO4·7H2O 65, CoCl2·6H2O 0.5, boric acid 0.02, H2SO4 5 mL. All other chemicals of analytical grade were supplied from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China) unless otherwise indicated.
Seed Culture
The first inoculum culture was prepared from one colony of P. pastoris suspended in 50 mL sterilized YPD broth containing 100 µg/mL zeocin (Invitrogen, Carlsbad, CA). The culture was incubated at 30 °C in a 500-mL baffled shake-flask on rotary shaker at 250 rpm. After the OD600 reaches 2–6 in 18–24 h, a second inoculum culture was prepared by transferring the first inoculum 10 (v/v) into a 2-L baffled shake-flask containing 400 mL sterilized YPD medium. The second inoculum culture was then incubated under the same condition as the first inoculum culture for 12 h.
Fermentation Scale-up
The BSM (3 L) was inoculated with 10% (v/v) second inoculum into a 5-L bioreactor (BIOTECH-5BG, Baoxing Co., Shanghai, China). The initial OD600 of the culture in bioreactor was about 0.5. A four-phase fermentation protocol (glycerol batch, glycerol fed-batch, starvation period and constant-rate methanol feeding) was used. The glycerol or methanol feeding to the bioreactor was controlled by a pump. The bioreactor was operated at 30 °C and pH around 6.0 via adding 28% v/v ammonia. Dissolved O2 cascade was constantly maintained above 30% air saturation.
Once glycerol was depleted from culture broth, indicated by a sharp increase in DO, the glycerol fed-batch phase was started at a constant flow rate of 18 mL/(L·h) with 50% (v/v) glycerol until the biomass reached about 180 g/L (wet cell density). After 1 h starvation period following the above high cell density fermentation, the culture was supplied with 100% (v/v) methanol to induce lipase expression and linearly ramped to maximum methanol feeding rates of 2, 3, 4 and 5 mL/(L·h) with an increasing rate of 1 mL/(L·h). Samples were taken at regular intervals to monitor the biomass, total protein concentration, lipase activity and alcohol oxidase activity.
Biomass, Total Protein Concentration, Lipase Activity, Alcohol Oxidase Activity
WCD of the cell suspension was determined by centrifugation of 10 mL cell broth in a pre-weighed centrifuge tube at 8000 × g at 4 °C for 10 min, and the fermentation supernatant was collected and used for subsequent experiments. Total protein concentration in the supernatant was determined by the Bradford assay [29]. The activity of lipase MAS1 in supernatant was determined by alkali titration method using olive oil as substrate [30]. Olive oil (Macklin, Shanghai, China) was emulsified with 4% (w/v) polyvinyl alcohol at the ratio of 1:3 (v/v). Each reaction contained 4 mL of emulsified olive oil, 5 mL of phosphate buffer at 50 mM and pH 6.0 and 1 mL of enzyme solution, and was carried out at 65 °C. The reaction was terminated by adding 15 mL of 95% (v/v) ethanol. The released fatty acids were neutralized by 0.05 M NaOH. One unit of lipase activity is defined as the amount of enzyme releasing 1 µmol of fatty acid per minute. The AOX activity was determined using a previously reported method [31].
Cell Viability And Cell Death
The cell viability was measured using methylene blue dye exclusion technique [32]. The fresh fermentation broth was diluted and mixed with 0.1% (w/v) methylene blue in equal volume. After standing at room temperature for 10 min, the cells were observed under a microscope (MLS1, Mshot, China) through hemocytometer. To determine the effect of constant methanol feeding rate on cell death, cells were collected at the time point corresponding to the maximum enzyme activities, washed with PBS buffer (100 mM, pH6) and suspended in the same buffer (106 cells). Cell death was determined by propidium iodide staining kit (Sangon, Shanghai, China) with a fluorescence microscope (LSM800, ZEISS, Jena, Germany).
ROS detection
Cells were collected at the time point corresponding to the maximum enzyme activities, washed with PBS buffer and suspended in the same buffer (106 cells). Cell suspension (500 µL) was mixed with 2', 7'-dichlorofluorescein diacetate (DCFH-DA, dissolved in ethanol, Sigma, Missouri) to a final concentration of 10 µg/mL followed by incubation at 30 °C for 30 min. The cells were collected and washed twice with PBS buffer, and the fluorescence density (FLU) was measured by a fluorescent plate reader (CytoFLEX, Beckman coulter, Brea, CA) under excitation wavelength at 488 nm and emission wavelength at 520 nm. The relative fluorescence density (RFLU) was also calculated as the fluorescence density divided by the number of cells examined [26].
O2•−, H2O2, SOD, CAT and GSH assays
Cells were collected at the time point corresponding to the maximum enzyme activities. The H2O2 content was calculated by measuring the absorbance at 390 nm. The cells were suspended in 3% trichloroacetic acid solution (2.5 mL), and centrifuged at 12000 × g and 4 °C for 10 min. Then 1 mL of the supernatant was mixed with equal volume of PBS buffer (pH 7), followed by adding 2 mL 1 mol/L potassium iodide.
The cells were resuspended in PBS buffer (50 mM, pH 7.8) containing 1 mmol/L EDTA and 1% (v/v) PVP, sonicated and then centrifuged at 12000 × g and 4 °C for 10 min. The supernatant was used for O2•−, sSOD activity and CAT activity analysis, and protein concentration in the supernatant was determined by the Bradford assay. The effect of constant methanol feeding rate on O2•− content was measured by determining nitrite production [33]. SOD activity, CAT activity and GSH content were determined by their cellular analysis kits, respectively (Nanjing Jiancheng BioENG, Co., Nanjing, China).
Determination of lipid peroxidation
Cells were collected at the time point corresponding to the maximum enzyme activities, washed with PBS buffer and suspended in the same buffer. MDA was quantified by measuring thiobarbituric acid reactive substances as described previously [34]. The cell suspension treated with snailase and digestion buffer (Sangon Biotech, shanghai, China) were centrifuged at 10,000 × g for 15 min at 4 °C. One volume of the supernatant was mixed with two volumes of TBA reactive (0.25 M chlorhydric acid, 15% (v/v) trichloroacetic acid and 0.375% (w/v) thiobarbituric acid). Subsequently, the samples were incubated for 20 min at 100 °C in a dry bath, and then the mixture was cooled on ice and centrifuged at 12,000 × g for 30 s at 4 °C. Supernatant absorbance was measured at 532 nm.
RNA isolation and quantitative real-time PCR (RT-qPCR)
Cells were collected at the time point corresponding to the maximum enzyme activities. Total yeast RNA was extracted using RNAiso Plus (Takara, Dalian, China) according to the manufacturer’s instructions. The cDNA was synthesized using PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Dalian, China). RT-qPCR was conducted in CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA), and SYBR Green PCR Master Mix kit (Takara, Dalian, China) was used for the real-time PCR analysis. The primers used for RT-qPCR are listed in Table 2. The relative expressions of target genes were calculated by the 2−ΔΔCt method [35].
Table 2
List of primers used to amplify mRNA by quantitative qRT-PCR
Gene
|
Forward primer (5′-3′)
|
Reverse primer (5′-3′)
|
Actin
|
GTCCAGCATAAACACGCCG
|
CAGTGGGAAAAACCCACGAA
|
cSOD
|
CGAACAATCCTCCGAAAG
|
ACCCTTGGCAACACCTTCA
|
mSOD
|
AAACAAGGAGGTGGAGAGC
|
CAAAGGGACCAAACTACC
|
CAT
|
GCTACTAACCTGAAGGACGC
|
TTGAAGTTTACGACACCCAG
|
GPX1
|
CCCATTAGATAAGAAAGGCG
|
CCAAACTGGTTACAGGGAA
|
GLR1
|
AACTTCGCCCAACCGTAT
|
TCTCAATCGCCAAGGACT
|