Cells and drugs
The K1 and BCPAP cell lines were purchased from Guangzhou Cellcook Biotech Co. (Guangzhou, China). The TPC-1 and KTC-1 cell lines were purchased from the Chinese Academy of Science (Shanghai, China). All cell lines were identified by short tandem repeat (STR) analysis, and cultured in RPMI 1640 (Gibco) supplemented with 10% fetal bovine serum, penicillin/streptomycin (5,000 units/mL, Gibco) and l-glutamine (2 mM, Gibco). The passage number of cells used for the experiments was approximately 20-30. All cell lines were tested for mycoplasma contamination. Selumetinib (selleck) and SHP099 (selleck, a potent, selective, orally available SHP2 inhibitor) were used in the present study. The lentivirus containing the SHP2 shRNA plasmid was purchased from Genechem Co. (Shanghai, China).
RNA-Sequence Analysis (RNA-Seq)
RNA was extracted from PTC cell lines BCPAP and its MEKi-resistant models BCPAP-R. The samples were then processed for RNA-sequencing using the NuGen Ovation Human FFPE RNA-Seq Multiplex System. Total RNA from biological triplicates (4 MEKi-resistant cell clones and 4 original cell clones) was isolated, quality was determined (Bioanalyzer), rRNA was depleted with RiboMinus, multiplexed paired-end libraries were prepared with Illumina TruSeq, and sequencing was performed on an Illumina HiSeq. Quality of the sequencing was determined by running FastQC. GSEA analysis was performance to identify enriched pathway and activiated network modules. All the data have been deposited to GEO/SRA with access id: doi:10.5061/dryad.1zcrjdfqh.
Cell viability assay
Cells were seeded into a 96-well plate at 500 cells per well. After incubation for 24 hours, these cells were treated with DMSO, SHP099 (10µM), selumetinib (Sel, 1µM), or the inhibitor combination (Comb) at various drug concentrations. After the indicated period of time, these cells were incubated with the CCK8 substrates (5 mg/mL) for two hours. The optical density was measured at 450 nm.
Colony formation assay
Cells were seeded into a 24-well plate at 200 cells per well. After 24 hours, these cells were cultured with the indicated inhibitors for two weeks. Then, these cells were stained with 0.05% crystal violet before photography.
Cell cycle analysis
The treated cells were fixed in cold 70% ethanol, and incubated at 4°C overnight. After incubation, these cells were resuspended in PBS buffer supplemented with 60 µg/mL of RNase A and 25 µg/mL of propidium iodide (PI) for 15 minutes in the dark at room temperature. Then, the samples were analyzed using a FACS Calibur flow cytometer (BD Biosciences).
Western blot and RTK arrays
Cells were lysed in modified RIPA buffer containing 1% PMSF. Equal amounts of total protein were resolved by SDS-PAGE, and transferred onto PVDF membranes (Millipore). Then, these membranes were immunoblotted overnight with the primary antibodies. The primary antibodies used for the western blot were p-MEK, MEK, p-ERK (Cell Signaling Technology, 4370), ERK (Cell Signaling Technology, 4695), SHP2 (ABCAM, ab32083), p-SHP2 (ABCAM, ab62322), and GAPDH (Cell Signaling Technology, 5174). The human phospho-RTK arrays were purchased from R&D Systems (ARY001B), and were used according to manufacturer’s guidelines.
Animal experiments
All animal experiments were approved by the Tianjin Medical University Cancer Institute and the Hospital Animal Care and Use Committee, and these were performed according to the IACUC protocol. The thyroid cancer cell line xenografts were established through the subcutaneous injection of 1×105 cells into 4-week-old male NSG mice. When the tumor volumes reached approximately 15 mm3, these animals were randomly assigned into four groups: first group (Ctrl), mice were orally treated with DMSO, q.d; second group (SHP099), mice were orally treated with 50 mg/kg of SHP099, q.o.d; third group (Sel), mice received daily oral doses of selumetinib, 20 mg/kg; last group (Comb), mice were treated with the combination therapy. In order to establish the drug resistance model in vivo, ten mice with similar-volume PTC xenografts received oral doses of selumetinib, at 20 mg/kg, once daily. After 15 or 40 days, representative xenografts in two groups were picked for the human phospho-RTK arrays. Remaining xenograft from 40 days treated mice was cut into equal sections, and planted into other mice. After seven days, planted animals were randomly assigned into four groups, and treated as described above. At the indicated time points, these animals were sacrificed, and the tumors were excised for further analysis. A transgenic mouse model of spontaneous PTC was established as previous described. In our conditions, the mice spontaneously developed PTC at 6-12 weeks of age. According to weight, six-week-old TPO-Cre BrafCA mice were randomly assigned into four groups: first group (Ctrl), mice were orally treated with DMSO, q.d; second group (SHP099), mice were orally treated with 50 mg/kg of SHP099, q.o.d; third group (Sel), mice received daily oral doses of selumetinib, 20 mg/kg; last group (Comb), mice were treated with the combination therapy.
Immunohistochemistry (IHC)
IHC was performed according to standard protocols. The primary antibodies used for the IHC assays were p-ERK (Cell Signaling Technology, 4370) and Ki67 (Cell Signaling Technology, 9027). The stained slides were independently examined by two pathologists, who were blinded to the treatment information. Hematoxylin and eosin staining were performed by the Department of Pathology of Tianjin Medical University Cancer Institute and Hospital.
RT-PCR
The RT-PCR assays were performed as previously described [17]. The primers were listed as Table 1.
Table 1
The primers of RT-PCR assays.
|
FORWARD
|
REVERSE
|
ETV1
|
CTTAGCCGTTCACTCCGCTAT
|
TCTGTCTTCAGCAGTGGACG
|
ETV4
|
GCCCATTTCATTGCCTGGAC
|
TACACGTAACGCTCACCAGC
|
ETV5
|
TAGAACCGGAAGAGGTTGCTC
|
TTATCCGGGAAAGCCATGGAG
|
FOSL1
|
CAGCCCAGCAGAAGTTCCA
|
ACTGAGGGTAGGTCAGAGGC
|
Statistical analysis
Data were represented as mean±SD of three independent experiments. The statistical analysis was performed using SPSS (IBM Corporation, Armonk, NY, USA) and GraphPad Prism 8.0 software (La Jolla, CA, USA). T tests and ANOVA tests were used for determining statistically significant difference (*P<0.05, **P<0.01, ***P<0.001, compared with Ctrl, @P<0.05, @@P<0.01, @@@P<0.001, compared with Comb) between different inhibitor treated and its control conditions.