Cell culture and treatment
Human colon cancer cell line SW480 and human embryonic kidney cell line 293T were purchased from ATCC. To induce OXA resistant SW480 cells, the cells were seeded onto 24 well plate before chemotherapeutics treatment. Next, SW480 cells were cultured in the presence of 0.5 mM oxaliplatin (OXA) for 24 hours followed by three days in fresh medium without a drug. This procedure was continued for six months with drug concentration increase 0.4μM per month, and the final concentration is 2.5 mM. Both of SW480 and SW480/OXA cells were cultured in Dulbecco Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin solution in a cell incubator at 37 °C, 5% CO2, with saturated humidity.
Hoechst 33342 staining
Cells were seeded onto fibronectin coated 12 well plate, after treatment, 5 mg/ml Hoechst 33342 staining solution (Solarbio, Beijing, China) was added to cells and incubated for 20 mins at room temperature. Then cells were washed with PBS for three time. Images were collected by Nikon T1-SAM.
Real-time PCR
Total RNAs were isolated from cells using TRIzol (Invitrogen, USA) according to the manufacturer's instruction. First stand of cDNA was synthesized by the Reverse Transcription Kit (Applied Biosystems, USA). Real-Time PCR reaction was performed using SYBR Green PCR Master Mix (Applied Biosystems). U6 and GAPDH were used as internal references. The relative levels were calculated by the 2-△△Ct method. Primer sequences used in the study were: GAPDH: 5’TGTTCGTCATGGGTGTGAAC3’ (forward) and 5’-ATGGCATGGACTGTGGTCAT3’ (reverse), RASA1: 5’CAGTGGACGAAGGTGACTCT3’ (forward)and 5’-AGGCGTTCTTCTGCTATCGT3’ (reverse), U6: 5’ -CTCGCTTCGGCAGCACA3’ (forward) and 5’AACGCTTCACGAATTTGCGT3’ (reverse), All: 5’CTCAACTGGTGTCGTGGA3’, miR-188-5p: 5’CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCCTCCAC3’ (forward) and 5’-ACACTCCAGCTGGGCATCCCTTGCATGGTGG3’ (reverse).
Luciferase activity assay
Luciferase constructs (psiECHECK-2, Promega) were made by ligating oligonucleotides containing the wild type or mutant type of RASA1 3’UTR downstream of the luciferase gene. Cells were co-transfected with RASA1 (WT/MUT) and NC or miR188 mimics by Lipofectamine 2000 (Invitrogen). Luciferase activity was detected 48 hours after transfection by a luciferase reporter gene assay kit (Sigma). Experiments were performed in triplicate in three independent experiments.
Cell transfection
miR-188-5p inhibitor, mimics, RASA1 siRNA and RASA1 overexpressed plasmid were purchased from Shanghai GenePharma and transfected to cells by Lipofectamine 2000 according to manufacturer’s instructions.
Western blot
The cells were harvested and disrupted in lysis buffer containing phosphorylase inhibitor cocktail (Roche) and phenylmethanesulfonyl fluoride (PMSF). An equal amount (30 mg) of each protein sample was electrophoresed on an 8-12% SDS–polyacrylamide gel and transferred onto polyvinylidene fluoride (PVDF) membranes. Subsequently, the membranes were incubated with specific antibodies after being blocked using 5% skimmed milk powder for 1 h at room temperature. The main primary antibodies included p21 (Abcam, ab227443, 1:1000), RASA1 (Abcam, ab2922, 1:1000), Ras-GTP (Abcam, ab69747, 1:2000) and GAPDH (Abcam, ab9485, 1:5000) were added to incubate at 4°C overnight. Goat anti-rabbit (1:5000) or goat anti-mouse (1:5000) IgG-HRP (Sigma) were added and incubated at room temperature for 1 h. The relative expression of the target protein was divided by an internal control.
Immunofluorescence assay
Cells were seeded onto fibronectin coated 12 well plate, after treatment, cells were fixed by 4% paraformaldehyde at room temperature for 10 mins and block by 1% BSA in PBS. The slides were incubated with the primary antibody (RASA1, Abcam, ab2922) at room temperature for 1 hour and washed three times with PBS. Alexa Fluor 555 goat anti-mouse secondary antibody (Abcam, ab150114) was used. After incubation with secondary antibody at room temperature for 40 mins, the slides were washed with PBS for three times and DAPI was used to stain the DNA.
Apoptosis assay
Cell apoptosis was performed by flow cytometry. Using ANXN V FITC Apoptosis Kit (#556547, BD Biosciences, USA) according to manufacturer’s instructions, double staining with FITC-Annexin V and propidium iodide (PI) of cells were performed and analyzed suing a FACScan® flow cytometer (BD, USA). Experiments were performed in triplicate.
Cell cycle analysis
Cells (2×105 /well) were seeded onto 6 well plate. Twelve hours later, cells were transfected. Forty eight hours after transfection, cells were harvested, fixed in 1 % paraformaldehyde, washed with PBS, and stained with 5 mg/ml propidium iodide (PI) in PBS supplemented with RNase A (Roche) for 30 mins at room temperature. The cells were analyzed using FACS Calibur flow cytometer. One parameter histogram was plotted according to the distribution of nuclear DNA content in each cell detected by flow cytometer. Cells in each individual phase of the cell cycle were determined based on their DNA ploidy profile.
Statistical analysis
The statistical analysis was performed using SPSS 15.0 (SPSS, USA) with unpaired two-tailed student’s t test. For multivariate groups comparison, ANOVO was performed. *P<0.05, **P<0.01, ***P<0.001.