Cell lines and cell culture
Laryngeal carcinoma cell lines Hep-2 and AMC-HN-8 were gained from the Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences. Neoplasic cells were cultured in DMEM (Gibco Corporation, USA) which was supplemented with 1% penicillin / streptomycin (Invitrogen) and 10% fetal bovine serum (Hyclone, USA). For normoxic conditions, cells were placed in an incubator at 37°C in an atmosphere of 21% O2, 74% N2 and 5% CO2. For hypoxic conditions, cells were placed in a hypoxic incubator (NuaireTM US autoflow CO2 water jacketed incubator) at 37°C containing 1% O2, 94 % N2 and 5% CO2.
Cell transfection
The double-stranded siRNA oligonucleotide targeting human Notch1 gene (Notch1-siRNA) (sense: 5'‑CAGGGAGCAUGUGUAACAUTT‑3', anti-sense: 5'‑AUGUUACACAUGCUCCCUGTT‑3') and the scrambled siRNA (sense: 5'‑UUCUCCGAACGUGUCACGUTT‑3', antisense: 5'‑ACGUGACACGUUCGGAGAATT‑3') were both synthesized by Shanghai Genepharma Co. Ltd. (China). After 24 hours of culture in antibiotic-free medium, laryngeal cancer cells were transfected with siRNA (100 nM) using Lipofectamine 2000. Then, cells should be collected for further examine after transfection for 24 hours.
Real-time PCR analysis
Trizol reagent (Invitrogen) extracted total RNA from neoplastic cells. According to reverse transcription kit instructions, cDNA synthesis was implemented. The primers for PCR were as follows: Notch1 forward, 5'‑CTACCTGTCAGACGTGGCCT‑3' and reverse, 5'‑CGCAGAGGGTTGTATTGGTT‑3'. Hes1 forward, 5'‑TCTGAGCCAGCTGAAAACAC‑3' and reverse, 5'‑GGTACTTCCCCAGCACACTT‑3'. Hey1 forward, 5'‑GGCTCCTTCCACTTACTGTCTC‑3' and reverse, 5'‑ ACTTTCCCCTCCCTCATTCTAC‑3'. MDR1 forward, 5'‑CTTCAGGGTTTCACATTTGGC‑3' and reverse, 5'‑ GGTAGTCAATGCTCCAGTGG‑3'. Survivin forward, 5'‑CTTCATCCACTGCCCCAC‑3' and reverse, 5'‑ ACTTTCTCCGCAGTTTCCTC‑3'. GAPDH (internal control) forward, 5'‑CATCTTCCAGGAGCGAGA‑3' and reverse, 5'‑TGTTGTCATACTTCTCAT‑3'. As conducted in our previous study [4], Real-time PCR quantified the expression of Notch1, Hes1, Hey1, MDR1, survivin and GAPDH mRNA using SYBR Green PCR kit (Takara Biotechnology Co., Ltd., Dalian, China). Real-time PCR results were analyzed by the 2-△△CT method [17].
Western blot analysis
Laryngeal cancer cells were collected and lysed with RIPA lysis buffer for half an hour. Equal amounts of lysate proteins (25 μg) went electrophoresis in SDS-PAGE (5% stacking gel and 8% separating gel) and transferred to a PVDF membrane (Millipore), blocked with 5% skim milk solution for 2 hours at room temperature. Then, the membranes were incubated with primary antibodies (Notch1 1:1000, rabbit anti-human; N1ICD 1:1000, rabbit anti-human; Survivin 1:1000, rabbit anti-human; MDR1/P-gp 1:200, mouse anti-human; GAPDH, 1:1000, mouse anti-human) overnight at 4˚C, and the secondary antibodies (1: 5000; room temperature, 1 hour). Finally, the immunoreactive proteins were visualized by electrogenerated chemiluminescence.
Cell cytotoxicity assay
CCK-8 assay was to assess the sensitivity of neoplastic cells to adriamycin, paclitaxel, cisplatin, 5-FU and gemcitabine. The cells were placed in 96-well culture panels (5×103 cells/well). After 12 hours, cells were dealed with a certain dose of chemotherapeutic drugs and cultured for another 48 hours under hypoxia or normoxia. As mentioned in previous study [4], the drug concentration (IC50) which lead to a 50% reduction in cell number could be calculated.
Rhodamine 123 accumulation assay
FCM assay was used to analyze the accumulation of Rh123 in Hep-2 and AMC-HN-8 cells as described previously [18]. The FACSCalibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) evaluated the cell suspension by using 488 nm excitation. Then, Cell-Quest™ software (BD Biosciences) analyzed the experimental data.
Cell apoptosis analysis
Hep-2 (3×105 cells/well) and AMC-HN-8 (4×105 cells/well) cells were plated in six-well plates and cultured overnight at 37˚C. Then, cells were cultured in hypoxia or normoxia for 12 hours after culture medium was renewed. Next, cell culture further lasted 48 hours after adding cisplatin to each well until the concentration reached 2.5×10-9 M. As our previous research, the apoptosis index (AI) of cells was assessed by FCM and Annexin-V-FITC/propidium iodide (PI) staining method [4]. Finally, cell apoptosis rate was measured at the average fluorescence intensity.
Statistical analysis
The comparison of quantitative variables was assessed by Student's t-test analysis with SPSS20.0. That values of P less than 0.05 was regarded as statistically significant.