2.1. Collection of biopsy specimens
Gastric biopsies were collected from 288 patients, in which both the antrum and corpus had been sampled by endoscopy. Biopsies were collected by physicians from patients indicated for gastric endoscopy at different hospitals in Khartoum State (Omdurman Medical Military Hospital, Al-Amal National Hospital, Police Hospital, Ibn Sina Hospital, and Fedail hospital) at the period from June/2018 to January/2019.
2.2. Preservation and processing of specimens
The specimens were immediately placed in thioglycollate broth, which provides anaerobic conditions until processing 15. Manual grinding of biopsies took place using disposable material 16.
2.3. Bacterial identification
The DNA of Helicobacter pylori has been extracted from specimens of the gastric biopsies using the guanidine chloride method 17. \ Biopsies were grinded by sterile blades and tips and then washed twice by phosphate buffer saline (PBS) to eliminate excess media. We add to the pellet 2 ml of lysis buffer, 10μl of proteinase K, 1 ml of guanidine chloride, and 300 μl of ammonium (NH4) acetate, vortexed and incubated at 65°C for 2 hrs. The mixture was cooled to ambient temperature, and then 2 ml of pre-cooled chloroform was applied, vortexed, and centrifuged for 5 min at 3000 rpm. The upper layer of the mixture was moved to a new tube, and 10 ml of absolute cold ethanol was applied, shaken, and held for 2hrs or overnight at -20°C. The tube was then centrifuged for 15-20 min at 3000 rpm, the supernatant was carefully removed, and the tube was inverted for 5 minutes on a tissue paper. The pellet was washed with 70 percent ethanol 4 ml, centrifuged for 5 min at 3000 rpm. The supernatant was poured away, allowing the pellet to dry for 10 min. \ Then re-suspended into 50 μl of distilled water, briefly vortexed, and held overnight at -20°C . The extracted DNA was stored at -70°C until use.
2.4. Polymerase Chain Reaction (PCR)
Two primer sets were used for the detection of the bacteria, targeting 16S rRNA (532bp) 18, and 23S rRNA (320bp). Allele-specific PCR was used for the detection of A2142G and A2143G point mutations using four primers called FP-1, RP-1, RP2142G, and FP2143G (Table 1). When the strain is wild type (wt), neither RP2142G nor FP2143G anneals with the template and polymerase chain reaction (PCR) amplification proceeds between FP-1 and RP-1, resulting in a 320bp amplicon. In the case of the presence of A2142G mutation, the PCR amplification primarily takes place between FP-1 and RP2142 G, which results in an amplicon of 238 bp. Similarly, in the case of the A2143G mutation, the PCR amplification goes between FP2143G and RP-1, resulting in an amplicon of 118 bp 19. The primers were dissolved according to manufacturer guidelines to prepare 10pmol/µl.
The first protocol used for amplification of 16S rRNA was as follows: initial activation at 94°C for 3 minutes, followed by 35 cycles at 94°C for 30s, 53°C for 30s, and 72°C for 45s, and a final extension at 72°C for 5 minutes (Table 1) 18.
The second protocol used for amplification of 23S rRNA was as follows: initial denaturation at 95°C for 5 minutes followed by 35 cycles of denaturation at 95 °C for 15s, annealing at 60.5°C for 20s, and extension at 68°C for the 30s and a final extension of 2 min at 68 °C (Table 1) 19.
Table (1): Primers sequences and PCR protocols used in this study
Protocols
|
Primer name
|
Primer sequence (5´-3´)
|
Amplicon size (bp
|
References
|
1st
|
16s RNA
|
GCTAA GAGA TCA GCC TAT GTCC
TGGCAATCAGCGTCAGGTAATG
|
532
|
18
|
2nd
|
FP-1
|
TCGAAGGTTAAGAGGATGCGTCAGTC
|
320
|
19
|
RP-1
|
GACTCCATAAGAGCCAAAGCCCTTAC
|
RP2142G
|
AGTAAAGGTCCACGGGGTATTCC
|
238
|
FP2143G
|
CCGCGGCAAGACAGAGA
|
118
|
2.5. DNA sequencing
A total of 25 samples of 23S rRNA (320bp) amplified genes were sent for sequencing (by BGI, business, China) for both strands of PCR products. The pairwise alignment was done for successful sequences by BLAST, and then multiple sequence alignment was done by BioEdit software 20. The sequences were compared with the 23S rRNA reference (U27270).
2.6. Statistical analysis
The obtained data were analyzed using IBM SPSS statistics 20. The chi-square test was used to compare the correlations and associations between variables (p-value ≤0.05 considered significant).