Cell culture
THP-1 cells were purchased from the American Type Culture Collection (ATCC) (Virginia, USA) and cultured in Roswell Park Memorial Institute Medium (RPMI-1640) (Sigma-Aldrich, US), supplemented with 10 % fetal bovine serum (FBS) (Gibco, Life Technologies, US) and 1 % penicillin/streptomycin (Gibco, Life Technologies, US) at 37 ºC in a humidified atmosphere containing 5 % CO2 and 95 % air.
Transfection with dsiRNA
STIM1 dicer-substrate siRNA (dsiRNA) (TriFECTa, Integrated DNA Technologies, US) was transfected in to THP-1 cells (2 x 106/ ml) at doses of 10, 20, and 50 nM for 24 to 72 h. STIM1 dsiRNA transfected to the cells using a Bio-Rad Gene Pulser Xcell electroporation system (Bio-Rad laboratories, USA) at pulse of 300 V for 7 microseconds. The transfected cells were diluted 20 - fold with culture medium and incubated at 37 ºC and 5 % CO2. All experiments were compared against a dsiRNA negative control.
qRT- PCR Analysis
Total RNA was extracted from the cells using Monarch® Total RNA Miniprep Kit (New England BioLabs, UK) 24 - 72 h post dsiRNA transfection. The cDNA was synthesized by reverse transcription using Rever Tra Ace® qPCR RT Master Mix (Toyobo, Japan) following the manufacture's protocol. Luna® Universal qPCR Master Mix (New England BioLabs, UK) and Step One Plus Real-Time PCR System (Applied Bioscience, US) were used to measure gene expression levels after STIM1 knockdown. The gene specific primers that used were as the following: STIM1 primers (F 5’-AGAAACACACTCTTTGGCACC-3’and R 5’-AATGCTGCTGTCACCTCG-3’), Akt primers (F 5'-CAAAGAAGTCAAAGGGGCTGC -3’ and R 5'- ATGTACTCCCCTCGTTTGTGC -3'), KRAS primers (F 5'-TCCAACAATAGAGGTGTTATTAAGC-3 and R 5'-ACTCGGGGATTTCCTCTTGA -3), PIK3CA primers (F 5'- ACGACTTTGTGACCTTCGGC -3' and R 5'-CCGATAGCAAAACCAATTTCTCGAT- 3'), MAPK primers (F 5'-GTACGACTCACTATAGGGAATTATGCATCCCACTGACCA-3’ and R 5’-AGGTGACACTATAGAATACTGGCTCGGCACACAGAT-3’), C-MYC primers ( F 5’-TGAGGAGACACCGCCCAC -3’ and R 5’-CAACATCGATTTCTTCCTCATCTTC-3’), NF-kB primers (F 5'- TAG GAA AGG ACT GCC GGG AT -3' and R 5'- CAC GCT GCT CTT CTT GGA AGG -3'), Bcl-2 primers (F 5’-ATCGCCCTGTGGATGACTGAGT-3’ and R 5’-GCCAGGAGAAATCAAACAGAGGC-3’), BAX primers (F 5’-TCAGGATGCGTCCACCAAGAAG-3’ and R 5’-TGTGTCCACGGCGGCAATCATC-3’), NOX2 primers (F 5'- CTT CAT TGG CCT TGC CAT CC -3' and R 5'- GGG TTT CCA GCA AAC TGA GG -3'), Rac1 primers (F 5’-GCCAATGTTATGGTAGAT-3’ and R 5’-GACTCACAAGGGAAAAGC-3’), FLT3 primers (F 5’-TTTCACAGGACTTGGACAGAGATTT-3’ and R 5’-GAGTCCGGGTGTATCTGAACTTCT-3’) and PKC primers (F 5'- CTT TCA TCC ACT GGC CTC GT -3' and R 5'- GTT GGG CTG CAT GAA CCT TG -3') . GAPDH was used as the endogenous control with primers F 5’-AACGGATTTGGTCGTATTG-3’ and R 5’-GCTCCTGGAAGATGGTGAT-3’.
Western Blot
Western blot was performed to confirm the suppression of STIM1 protein after dsiSTIM1 transfection. Protein samples (30 µg) were analysed by SDS-PAGE on 12 % gel. Following electro-blotting to Polyvinylidene Difluoride (PVDF) membrane, membranes were blocked in 5 % non-fat dry milk or 3 % bovine serum albumin (BSA) in 0.1 % TBST for 1 hour at room temperature. The membrane was rinsed in 1X TBST three times and incubated in the primary antibody solutions overnight at 4 ˚C with gentle rocking. The primary antibodies included Rabbit monoclonal anti-human STIM1 antibody (Cell Signalling Technology, USA) at 1:500 dilution in 5 % non-fat dry milk in 0.1 % TBST and Rabbit monoclonal anti-human ꞵ -actin antibody (Cell Signalling Technology, USA) at 1:2000 dilution in 3 % BSA in 0.1 % TBST. The membranes next day were washed with 1X TBST three times and incubated in HRP-conjugated polyclonal anti-Rabbit secondary antibody (Cell Signalling Technology, USA) at 1:500 dilution in 0.1 % TBST included non-fat dry milk or BSA, for 1 hour at room temperature. After washing with TBST, the membranes were incubated in the ECL substrate (Bio-Rad, USA) according to manufacturer’s directions. After incubation, the membranes were imaged using VersaDoc imaging system (Bio-Rad, USA). Band intensity was measured using Image Lab software version 6.1 (Bio-Rad, USA).
Proliferation Assay
THP-1 cells were seeded at 2 x 105 cells/ml in triplicate in 96 - well flat bottom plate after dsiRNA transfection. Cells incubated for 3 time points: 24, 48 and 72 h. At each time point, cell proliferation assessed by adding 10 µl of cell count reagent SF (nacalai tesque, Japan) and incubation for 2 h. Absorbance was measured at 450 nm using microplate reader (Bio-Tek, US).
Colony formation Assay
THP-1 cells were seeded, after dsiRNA transfection, in triplicate at 2 x 103 cells/ml in methylcellulose medium in 24 - well plate and incubated at 37 ºC for 8 days. The colonies were counted under light microscope (Olympus CKX 41) at magnification of 40x and 200x. The selected colonies were those consist of 50 cells or more.
Measurement of intracellular calcium level
THP-1 cells were seeded in triplicates at 5x105 cells /ml in 96 - well flat bottom plates for 24 h. After washing with PBS, the cells were suspended in 100 µl HEPES buffer saline loaded with 3 µM Fura-2AM (EMD Millipore, USA) and incubated for 30 minutes. Cells were washed with HEPES buffer saline and suspended in 100 µl calcium-free HEPES buffer saline and incubated for 1 hour at 25 C to permit dye de-esterification. After that, depletion of calcium stores was triggered by adding 200 nM thapsigargin (TG) (EMD Millipore, USA) to the cells followed by adding 2 mM CaCl2. Fluorescence intensity was measured at alternating 340 and 380 nm excitation and 510 nm emission using Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies, USA).
Measurement of intracellular ROS level
Cells were seeded in triplicates at 2 x 105/ml in 96 - well flat bottom plate. After 24 hour of transfection, the cells were washed with PBS, suspended in 100 µl PBS loaded with 5 µM CM-H2DCFDA (Invitrogen, US) and incubated for 30 minutes. After that, cells were washed and suspended in PBS for 1 hour. ROS level was measured using FLUOstar Omega microplate reader (BMG LABTECH, Germany) at 485 nm excitation and 520 nm emission. Fluorescent microscope (Olympus IX71, Japan) was used to visualize the fluorescent dye rising from the cells.
Statistical analysis
All statistical analysis was carried out using SPSS version 26. Comparison between the two groups was carried out using a paired sample student t-test. Data was considered significant when p ˂ 0.05 which presented as (*), very significant when p ˂ 0.01 (**), and extremely significant when p ˂ 0.001 (***).