2.1 Cell culture
The human HCC cell line (HepG2) was bought from the Cell Center of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in the Dulbecco modified Eagle's medium (DMEM) containing 10% fetal bovine serum (Gibco) and penicillin/streptomycin (Sigma, St.Louis, MO, USA) under 37°C/5% CO2 hypoxia (1% O2) or normoxia (21% O2).
Human umbilical vein endothelial cells (HUVECs) were purchased from Allcells (Shanghai, China) and cultured in the medium containing 50 U/mL penicillin and 50 U/mL streptomycin (Invitgen, San Diego, CA), 50 mL endothelial cell growth additive (Upstate, Temecula, CA), 2.2 g/L sodium bicarbonate, and 10% fetal bovine serum (Gibco, Grand Island, NY) under a humid environment at 37˚C with 5% CO2 [19].
2.2 Cell transfection
The pcDNA empty vector (NC), pcDNA-SOCS5 (SOCS5), miRNA control (miR-NC), miR-3156-5p mimics, miR-NC-in, and miR-3156-5p inhibitors were purchased from GenePharma Co., Ltd. (Shanghai, China). HepG2 cells were inoculated on 24-well cell plates (3×105 cells/well). After incubation at 37˚C with 5% CO2 for 24 hours, the cells were transfected using Lipofectamine® 3000 (Invitrogen; ThermoFisherScientific, Inc.). The transfection validity was measured via quantitative reverse transcription PCR (qRT-PCR). The cells were incubated at 37°C with 5% CO2 for 24 hours for further analysis.
2.3 Collection of conditioned medium (CM)
As mentioned previously [21], HepG2 cells overexpressing or knocking down miR-3156-5p were cultured in a normal growth medium (DMEM + 10% FBS + 1% penicillin/streptomycin) to 80% fusion. The cells were then washed twice with PBS and starved overnight in a serum-free medium (DMEM). Subsequently, they were treated with hypoxia (1% O2) for 12 hours. Thereafter, the culture supernatant was collected, centrifuged at 16000 rpm for 5 min to remove the cell debris, and stored at -80°C.
2.4 Cell counting kit-8 (CCK-8) assay
HepG2 cells were sub-cultured in 96-well plates for 24 hours. Next, they were randomly divided into the miR-NC group, the miR-3156-5p group, the NC-in group, and the miR-3156-5p-in group. After cell transfection, 10 µL CCK-8 reagent (Dojindo Molecular Technologies, Kumamoto, Japan) was added to each well according to the kit’s instructions and further incubated for two hours. The absorbance was observed with a microplate reader to calculate cell growth rate (proliferation ratio = cell absorbance/ 0 hour absorbance).
2.5 BrdU assay
Cell proliferation was examined with the 5-Bromo-2-deoxyUridine (BrdU) method. Briefly, the transfected HCC cells were inoculated in 96-well plates and cultured for 24 hours. The BrdU labeling reagent (Wuhan AmyJet Scientific Inc. Wuhan, China) was added according to sigma's instructions, and the plates were incubated with 5% CO2 at 37℃. After 48-hour incubation, immunofluorescence staining of cells was performed following the BrdU antibody operating instructions. The positive cell number and the total DAPI-positive cell number under the microscope were randomly chosen from three fields of view and counted. Cell proliferation rate = BrdU-positive cell number/DAPI-positive cell number, and the average value was taken.
2.6 Tube formation experiment in vitro
Endothelial cells were incubated at 37°C for 6 hours with CM of anoxic HepG2 cells in Matrigel matrix (BD Biosciences)-coated 24-well plates (1×104 cells/well). Images were then taken under the microscope, and analysis was performed with the Image Pro-Plus 6.0 software (National Institutes of Health, ×100). The tube length was measured [22].
2.7 Western blot (WB)
Mouse tumor tissues were collected and each 100 mg of tissue was lysed by 1 mL of pre-cooled tissue lysis solution. Subsequently, the tissues were subjected to homogenization by ultrasonic crusher (ice bath) and centrifugation for supernatant collection. The cells were retained, incubated with pre-cooled RIPA lysate (Beyotime Biotcchnology, Shanghai, China) on ice for 20 min, and centrifuged at 13000 rpm at 4℃ and for 20 min. Then, the supernatant was removed, and the protein quantification of mouse tumor tissues and cells was made with the BCA protein quantification kit. Afterward, the proteins were subjected to SDS-PAGE and transferred to PVDF membranes (Millipore, Bedford, MA, USA). After being blocked with 5% skim milk, the membranes were incubated with the primary antibodies (Abcam, MA, USA; 1:1000) of SOCS5 (ab97283), anti-HIF-1α (ab179483), anti-VEGF-A (ab52917), anti-JAK2 (ab108596), anti-p-JAK2 (ab32101), anti-STAT3 (ab68153), anti-p-STAT3 (ab267373), and anti-β-actin (ab227387) at 4℃. The membranes were cleaned three times the next day. Then, the TBST-diluted secondary antibody was added and incubated for one hour on a shaker at room temperature. Next, the membranes underwent three times of washing. The ECL chemiluminescence reagent (Amersham Pharmacia Biotech, Little Chalfont, UK) was tested in a gel scan analyzer and the results were analyzed. ImageJ was utilized to analyze the grayscale values of each band, and the ratio of the grayscale value of the target protein to the grayscale value of GAPDH served as the relative protein expression for analysis.
2.8 qRT-PCR
Total RNA was extracted from mouse tumor tissues and HepG2 cells with the TRIzol reagent. cDNA synthesis was implemented with the miScript II Reverse Transcription Kit (Qiagen, Hilden, Germany) or PrimerScript RT Kit (Takara Bio, Inc., Otsu, Japan) for miRNA and mRNA detection. The PCR reaction mixture (20 µL) was placed into a LightCycler 480 II real-time PCR instrument (Roche Diagnostics, Basel, Switzerland) and a miScript SYBR Green PCR kit (QIAGEN, Dusseldorf, Germany) to test miRNA or mRNA.The PCR conditions were as follows: predenaturation for 5 min at 95˚C, denaturation for 15 s at 95˚C, and annealing for 30 s at 60˚C. U6 was the endogenous control of miR-3156-5p, while GAPDH was that of HIF-1α and VEGFA, with the 2 (-ΔΔCt) method for statistics. Each experiment was conducted three times. Specific primer sequences are as follows:
The target | Forward (5 '-3') | Reverse (5 '-3') |
miR-3156-5p | GGTACCGCCGGGAGGGTCTGCC | CTCGAGTTCAATTTAACAACAAATTGCAAA |
HIF-1α | AAGTCTGCAACATGGAAGGTAT | TGAGGAATGGGTTCACAAATC |
VEGF-A | AAGGAGGAGGGCAGAATCAT | ATCTGCATGGTGATGTTGGA |
U6 | CGCTTCGGCAGCACATATAC | TTCACGAATTTGCGTGTCAT |
GAPDH | GCTCTCTGCTCCTCCTGTTC | ACGACCAAATCCGTTGACTC |
2.9 Dual-luciferase reporter assay
All luciferase reporting vectors (SOCS5-1-WT and SOCS5-1-MUT) were constructed by Promega (Madison, WI, USA). HepG2 cells (4.5×104) were inoculated in 48-well plates and cultured to 70% confluence. Then, they were co-transfected with SOCS5-1-WT, SOCS5-1-MUT and miR-3156-5p mimics or negative controls by Lipofectamine 2000. The luciferase activity was determined as per the manufacturer's instructions 48 hours after the transfection. We conducted all experiments three times.
2.10 RNA immunoprecipitation (RIP)
RIP was performed with the Magna RIP Kit (EMD Millipore, Billerica, MA, United States). After the cells were lysed with RIP buffer, the AgO-2 antibody (micropores) or the control antibody (normal mouse immunoglobulin, micropores) was added. After incubation overnight at 4˚C, the adsorbed lysates were retained, and the RNA was extracted. The SOCS5 expression was tested by qRT-PCR.
2.11 The xenograft model in nude mice
Twenty 5-week-old female BALB/c nude mice weighing 180–200 g were purchased from the Animal Experiment Center of Lanzhou University. The mice were kept in cages at 20–25℃ with 50%-52% humidity, with a light-dark cycle of 12 hours each. The mice could drink and eat at will. All experiments were authorized by the Ethics Committee of the First Hospital of Lanzhou University and were in line with the Guidelines of the National Institutes of Health on animal care and use. 2×106 HepG2 cells transfected with miR-3156-5p and the negative controls were injected into both armpits of the mice subcutaneously (n = 5), respectively, and tumor growth was observed. Tumor volume was measured 4, 8, 16, 24, and 32 days after the injection. The mice were killed on the 32nd day, and tumor volume (mm3) and weight (g) were determined. Tumor volume was calculated according to the following formula: volume = length × width2×0.5.
2.12 Immunohistochemistry (IHC)
After conventional paraffin embedding and sectioning (4 µM), the xenograft tumors were dewaxed with xylene and hydrated with gradient alcohol. The endogenous peroxidase was inactivated by blocking with 3% H2O2 for 10 min. Microwave repair was made with 0.01 mol/L sodium citrate buffer (pH = 6.0, 15 min). After blocking with 5% bovine serum albumin (BSA) for 20 min, the primary antibodies of SOCS5 (1:200), p-STAT3 (1:200), HIF-1α (1:200), and VEGFA (1:200) were added and incubated at 4˚C overnight. The next day, the goat anti-rabbit secondary antibody was added and incubated for 20 min at room temperature. Then, the sections were washed with PBS and visualized with DAB. After hematoxylin counterstaining, the sections were dehydrated and transparentized for mounting inspection.
2.13 Statistical analysis
T test was employed to compare the two groups of data, and the differences between multiple sets of data were compared by one-way analysis of variance. The differences between the two sets of data were analyzed by the post hoc test, and SPSS24.0 (SPSS Inc., Chicago, Illinois, USA) was employed to calculate the Mean ± SEM results in the experiment. The GraphPad 8.0 software was adopted for mapping, and P < 0.05 presented statistical significance.