Ethics approval
This study was approved by the medical ethics committee of the Women’s Hospital of Zhejiang University School of Medicine (Ethics Lot number 20170021). We confirm that human study in our experiments was performed in accordance with relevant guidelines and regulations.
Study population
A total of 100 patients, who underwent IVF or intracytoplasmic sperm injection treatment in the reproductive medical center of the Women’s Hospital of Zhejiang University School of Medicine during July 2017 and January 2018 were enrolled in this study. Of the 100 subjects, there were 50 with ovarian endometriosis and 50 in the control group. Patients with ovarian endometriosis were confirmed by laparoscopy in our hospital. Inclusion criteria included regular menstrual cycle (23-35 days), unilateral endometrioma (≥5 cm) and normal ovarian reserve (serum anti-Mullerian hormone level of > 1 ng/mL, antral follicular count > 4 and basal serum follicle-stimulating hormone level of <10 IU/L). Patients aged over 35 years, treated by steroid hormones, with pelvic inflammatory disease, endocrine diseases, unexplained infertility, with immune disease, or chromosomal abnormalities were excluded. Tubal blockage or male-factor infertility as two isolated causes comprised the control group.
Follicular Fluid and GC Isolation
During surgery, FF was collected using a new aspiration needle when the first and largest follicle of the ovary was punctured and with a flushed needle for the first follicle of the other ovary. Only FF samples free of blood contamination upon both visual and microscopic examination and that contained mature (MII) oocytes were analyzed. Samples were centrifuged at 2900 rpm for 10 minutes to remove cell debris before being stored. GCs samples was collected on the oocyte retrieval day according to the protocol [14]. Firstly, GCs were centrifuged at 340 × g for 5 minutes. Then they were gathered from the pellet with Ficoll solution (Lymphoprep; Axis-Shield, Norway) by density gradient centrifugation at 340 × g for 15 minutes. After that, GCs were resuspended in red blood cell lysis buffer (Beyotime, China) for purification and washed with phosphate-buffered saline solution (PBS; Gibco, USA). Both the FF and the GCs were stored at -80℃ until analysis.
Hormone and PGE2 Measurements
Serum hormone levels on days 2–5 of the menstrual cycle and trigger day of IVF, including FSH, LH, estradiol (E2), P and testosterone (T) levels in serum, as well as the level of P and PGE2 in FF were measured using ELISA kit following the manufacturer’s protocol (Beckman Coulter UniCel DxI 800, USA).
Cell culture and treatment
Granulosa tumor-like cell line KGN (Bena culture collection, China) was used as in vitro cell model [15]. Cells were cultured in RPMI medium (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (FBS, Biological Industries, Kibbutz Beit-Haemek, Israel), which were incubated at 37 ℃ and 5% CO2 in air. After 48 h of cell culture, the cells were pre-incubated in the serum-free medium for 12 h. Then the cells were cultured in serum-containing medium with progesterone dissolved with DMSO (1 × 10-6, 1 × 10-5, 1 × 10-4, 1 × 10-3, 1 × 10-2 nmol/L; sigma, USA) for 48 h or TNF-α (0–50 ng/mL; Sino Biological, China) for 10 h. Control cultures were exposed to medium added with the same volume of DMSO. Another group of cells were cultured in serum-containing medium with progesterone (1 × 10-4 nmol/L) for 0, 5, 15, 30, 60, 120 minutes respectively to explore the effects of progesterone on NF-кB signaling in vitro.
Quantitative Real-time PCR Analysis
The q-PCR analysis was carried out using SDS 2.3 software in 7900HT Fast Real-Time PCR System (Applied Biosystems, USA) according to the standard protocol (see in detail in supplementary methods).
Western blot analysis
Proteins were extracted from human GCs or KGN cells, and lysed by RIPA lysis buffer (Cell Signaling Technology, USA) according to the manufacturer's protocol [16]. Western blot analysis were conducted according to the standard protocol (see in detail in supplementary methods).
Immunofluorescence
The cells pre-treated with progesterone (1 × 10-4 nmol/L) for 0, 5, 15, 30, 60, 120 minutes respectively and immunofluorescence analysis were conducted according to the standard protocol (see in detail in supplementary methods).
Chromatin Immunoprecipitation
In vivo crosslinking of proteins was performed by incubating KGN cells pretreated with TNF-α with 1% formaldehyde for 15 minutes at room temperature. After neutralization with glycine, cell lysates were vortexed with glass beads in lysis buffer containing 100 mM HEPES-KOH pH 7.5, 1% Triton X-100, 0.1% sodium deoxycholate, 1 mM EDTA, 140 mM NaCl, 2X cOmplete ULTRA Tablets (protease inhibitors, Roche, Switzerland), 1 mM phenylmethylsulphonyl fluoride, 50 mM NaF and 0.2 mM Na3VO4. Samples were then sonicated using a Covaris-S2 sonicator (Covaris, USA) to shear chromatin DNA into fragments of 100 to 500 bp. Immunoprecipitation of P65 bound to chromatin was performed using protein G Sepharose beads that were coupled to a rabbit monoclonal anti-p65 antibody (8242S, 1:100, Cell Signaling Technology, USA). Bead washes and elution, reverse cross-linking, and DNA precipitation were performed according to the Pierce Agarose ChIP Kit manual. Rabbit IgG was used as negative control. PCR was carried out later using different sets of primers spanning the HPGD promoter to verify the binding. The primer succeeded to detect a band in our ChIP-PCR assay is HPGD-F (-1333): 5'-TTATGGGGTGGGAGGGAGAC-3', HPGD-R (-1189): 5'- TTCTGTCACCTCAGCATGCA -3'.
Transcriptome analysis
Total RNA was extracted from cell by Trizol reagent (Invitrogen, USA). The RNA quality was checked by Bioanalyzer 2200 (Aligent, USA) and kept at -80℃. RNA with RIN >8.0 was used for rRNA depletion. The cDNA libraries of each pooled RNA sample for single-end sequencing were prepared using Ion Total RNA-Seq Kit v2.0 (Life Technologies, USA) according to the manufacturer’s instructions. The cDNA libraries were processed for the Proton Sequencing process according to the commercially available protocols. Clean reads obtained from the raw reads by removing the adaptor sequences, reads with >5% ambiguous bases (noted as N) and low-quality reads containing more than 20 percent of bases with qualities of <13 were aligned to the human reference genome sequence GRCh38 (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38) using the MapSplice program (v2.1.6) [17]. Alternative Splicing Detector (ASD, available on http://www.novelbio.com/asd/ASD.html) was used as the tool to detect the differentially alternative splicing cases based on the bam file after mapping according to the P threshold (P<0.05) [18]. HTseq was used to count gene and RPKM method was used to normalize gene expression level [19]. DEseq algorithm was used to identify the differentially expressed genes under the criteria that fold change > 1.5 and FDR < 0.05 [20]. Gene ontology (GO) analysis was performed to facilitate elucidating the biological implications of unique genes in the significant or representative profiles of the differentially expressed genes in the experiment [21]. GO annotations were integrated from NCBI (http://www.ncbi.nlm.nih.gov/), UniProt (http://www.uniprot.org/) and the Gene Ontology (http://www.geneontology.org/). Pathway analysis was used to find out the significant pathway of the differential genes according to KEGG database. Fisher’s exact test were applied to identify the significant GO categories and pathways, and the false discovery rate (FDR) was used to correct the P-values. [22].
Statistical analysis
The results are presented as mean ± SEM. Quantitative variables were analyzed using Student's t-test for comparison between two groups. Statistical analysis was performed with Statistical Package for Social Sciences version 22.0 (SPSS 22.0). P< 0.05 was considered statistically significant.