OVX-induced experimental OP mouse model
Eight- to ten-week-old female C57BL/6J WT mice were purchased from Tianqin Biotechnology Co., Ltd., Changsha, China. All mice were maintained under continuous 12 h light followed by 12 h dark cycles and pathogen-free conditions. An experimental OP mouse model was induced by bilateral ovariectomy, and control mice were subjected to sham operation. All mice were euthanized for collection of bilateral femur specimens at 12 weeks after surgery. The harvested distal femurs were fixed, decalcified, embedded in paraffin, and cut using our previously established protocol[22]. Routine hematoxylin and eosin (H&E) staining was used to evaluate bone morphology. All the experimental procedures were approved by the Committees of Animal Ethics and Experimental Safety of Hainan Medical University.
MicroCT analysis
The whole secondary spongiosa of the distal femur was scanned ex vivo using a microCT system (μCT100, SCANCO MEDICAL, Switzerland). The trabecular bone was segmented for three-dimensional reconstruction (μCT Evaluation Promgram V6.6, SCANCO MEDICAL, Switzerland) to calculate the following parameters: BV/TV, Conn.D, SMI, trabecular number (Tb.N), Tb.Th, trabecular separation (Tb.Sp), BS/BV and BMD of TV.
Isolation and culture of mouse BMSCs
For isolation of mouse BMSCs, four- to six-week-old female mice were pretreated in 75% ethanol solution after the necks were broken for 10-15 min. Bilateral femurs were dissected under sterile conditions. The marrow cavity was repeatedly flushed with 0.0067 M sterile phosphate buffered saline (HyClone, South Logan, UT, USA). The collected bone marrow cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco). After 24 h, the cell culture supernatant was discarded, and fresh complete medium was added. When cells reached 85%-90% confluence, 0.25% trypsin (Gibco) containing 10 mM EDTA was used to digest cells. Only third- to eighth-passage BMSCs were employed to induce osteogenic and adipogenic differentiation as well as to transfect agomir-483-5p or antagomir-483-5p (GenePharma, Suzhou, China). Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was used for transfection.
RNA extraction and real-time PCR
Total RNA was extracted from the collected cells using TRIzol reagent (Invitrogen). To analyze ALP, Bglap, MAKP1, and Smad5 levels, a Thermo Scientific RevertAid first strand cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to synthesize complementary DNAs (cDNAs). The primers (Sangon Biotech, Shanghai, China) used are described in Supplementary Table 1. PowerUP SYBR green master mix (Thermo Fisher Scientific, Waltham, MA, USA) was used to quantify the relative mRNA levels. To analyze miR-483-5p levels, the U6 snRNA real-time PCR normalization kit and the mmu-miR-483-5p hairpin-it real-time PCR kit (GenePharma) were used.
Enzyme-linked immunosorbent assay (ELISA)
To detect ALP levels in cell culture supernatant, a mouse ALP ELISA kit (AMEKO, Shanghai, China) was used. A mouse Col-1 ELISA kit (AMEKO) was used to measure the concentration of type I collagen in the cell culture supernatant according to the manufacturer's instructions.
Osteogenesis differentiation and alkaline phosphatase staining.
To induce osteogenic differentiation of BMSCs, cells were transfected with agomir-483-5p (GenePharma), antagomir-483-5p, or negative control (NC). 6 h after transfection, cells were cultured with medium containing 10 mM β-glycerophosphate (Biosharp, Hefei, China) , 1 μM dexamethasone (Sigma-Aldrich, St. Louis, MO, USA), and 50 μM ascorbic acid (Solarbio, Beijing, China) for 48 h. Alkaline phosphatase activity was monitored using a BCIP/NBT Alkaline Phosphatase Color Development Kit (Beyotime, Shanghai, China). The lentivirus-mediated miR-483-5p mimics and lentivirus-mediated miR-483-5p inhibitor were purchased from GenePharma. For continuous induction, the fresh medium was changed every two days.
Preparation of FAM-BMSC-aptamer-nanoparticles
First, mouse IgG (Solarbio) was used to package agomir-483-5p or antagomir-483-5p (GenePharma) following the methods described previously19. Then, 1 mL (400 mM) of N-ethyl-N-(3-diethylaminopropyl) carbodiimide (EDC) (Thermo Fisher Scientific) and 1 mL (100 mM) of N-hydroxysuccinimide (NHS) (Thermo Fisher Scientific) were added to activate terminal carboxyl groups on the surface of nanoparticles. After gentle stirring for 15 min, a total of 5 OD BMSC-targeting-aptamers (5’ 6-FAM-ACGACGGTGATATGCCAAGGTCGTATGCACGAGTCAGAGG-C7-NH2-3’) (Sangon Biotech) was added, and incubated at room temperature for 2 h in the dark with gentle shaking. Finally, 0.2% v/v poloxamer-188 (Sigma-Aldrich, St. Louis, MO, USA) was used to coat FAM-BMSC-aptamer-nanoparticles following methods reported previously19.
Characterization of FAM-BMSC-aptamer-nanoparticles
Particle average hydrodynamic diameters, PDIs, and zeta potentials were measured by a NanoBrook Omni Analyzer (Brookhaven Instruments Corporation, NY, USA). The fluorescence emission spectrum of the FAM-BMSC-aptamer-nanoparticles was determined using a luminal fluorescence spectrometer (Thermo Fisher Scientific). The shape of the nanoparticles was evaluated using a HT-7700 transmission electron microscope (Hitachi, Tokyo, Japan). Biotium’s next-generation fluorescent CF® -labeled wheat germ agglutinin (CF®555 WGA) was used for plasma membrane imaging on a fluorescence microscope (Olympus, Tokyo, Japan).
Therapeutic inhibition of miR-483-5p in BMSCs of OVX mice.
Experimental OP model OVX mice were induced as described before. FAM-BMSC-aptamer-nanoparticles carrying agomir-483-5p (5 mg/kg body weight) or antagomir-483-5p (5 mg/kg body weight) were delivered by tail vein injection every week. After 12 weeks, mice were euthanized, and bilateral femur specimens were collected. Left femur specimens were prepared for microCT scans and right femurs were prepared for immunohistochemistry staining.
Cell culture.
The C3H/10T1/2, Clone 8 cell line (ATCC, Manassas, VA, USA) was maintained in alpha-modified Minimum Essential Medium (α-MEM, Gibco) containing 10% FBS (Gibco), 2 mM Lglutamine (Gibco), 1% MEM non-essential amino acids solution (100X) (Gibco), and 1 mM sodium pyruvate (100 mM) (Solarbio). Cells were maintained under a standard cell culture conditions with 5% CO2 and 95% humidity, and they were not used beyond passage 10.
MAPK1 and Smad5 3′ UTR cloning and Luciferase Assay.
MAPK1 (gene ID 26413) and Smad5 (gene ID 17129) mRNA 3′ UTRs containing the miR-483-5p-binding sequences were amplified by routine PCR. The MAPK1 mRNA 3′ UTRs fragment was amplified using the following primers 5′- CCGCTCGAGTCAGAGGACTGGACGAGTTC -3′ (forward) and 5′- AAGGAAAAAAGCGGCCGCAGCCTCCCTACTGTGAAGTG -3′ (reverse). The Smad5 mRNA 3′ UTRs fragment was amplified using the following primers 5′- CCGCTCGAGACAGTCTCCCTATGCCTGAG -3′ (forward) and 5′- AAGGAAAAAAGCGGCCGCTACTCTGCAGTGCATGCCTG -3′ (reverse). The PCR products were subcloned into the psiCHECK™-2 vector (Promega, Madison, WI, USA) through Not I and Xho I (Thermo Fisher Scientific) cloning sites. The binding region mutations were achieved using gene splicing by overlap extension PCR (SOE-PCR). C3H/10T1/2 cells were cotransfected with agomir-483-5p and the constructed plasmid. The dual-luciferase reporter assay system (Promega) was used to measure firefly and renilla luciferase activities on a Spectramax i3x (Molecular Devices, CA, USA).
Inhibition and overexpression of MAPK1 and Smad5
RNA interference was used to knockdown MAPK1 and Smad5 in BMSCs. siRNA-MAPK1 and siRNA-Smad5 (Table S2) were synthesized by Sangon Biotech. Overexpression plasmids of the MAPK1 or Smad5 gene were constructed by VectorBuilder. After transfection of the siRNAs or plasmids into cell, the protein levels of MAPK1 and Smad5 were detected by western blot assays. For western blot analysis, rabbit anti-MAKP1 (1:1000) and rabbit anti-Smad5 (1:1000) polyclonal antibodies (ABclonal) were employed as primary antibodies. A HRP-conjugated AffiniPure goat anti-rabbit IgG (H+L) (Proteintech, IL, USA) was used as the secondary antibody and visualized using an enhanced chemiluminescence kit (Biosharp).
Immunohistochemistry staining
After routine deparaffinization and rehydration, all sections were incubated in citrate buffer (0.01 M, pH 6.0) at 60°C for 16-18 h for antigen retrieval. Sections were then covered with 3% hydrogen peroxide for 10 min in the dark to inactivate endogenous peroxidase activity. Sections were permeabilized and blocked in 1% goat serum supplemented with 0.2% Triton X-100 (Beyotime) at room temperature for 30 min. Sections were then incubated overnight at 4 °C with rabbit anti-MAKP1 (1:100) and rabbit anti-Smad5 (1:100) polyclonal antibodies (ABclonal). A HRP-conjugated AffiniPure goat anti-rabbit IgG (H+L) (Proteintech) was used as the secondary antibody and visualized using a DAB detection kit (Origene, Beijing, China).
Statistical analyses
All numerical data are presented as the mean ± SEM. All statistical analyses were performed with GraphPad Prism software, version 6.01 (La Jolla, CA, USA). Statistical differences between two groups were determined by the unpaired t test. One-way ANOVA with Dunnett's multiple comparison posttest was used to compare significant differences among multiple groups. All experiments were repeated at least three times, and representative experiments are shown. P < 0.05 was considered statistically significant (*P < 0.05; **P < 0.01; ns, nonsignificant).