Clinical Samples
A total of 24 tissue specimens were obtained from low grade glioma (LGG, WHO II, n = 8), tumor center (n = 8) and peri-tumor edema zone (PTEZ, n = 8) of GBM in the Second Affiliated Hospital of Zhejiang University School of Medicine from January 2017 to January 2018. Glioma was diagnosed according to the 2016 WHO Classification of Tumors of the Central Nervous System. Written informed consents were obtained from all the patients receiving surgical interventions. The study was approved by the Ethical Committee of the Second Affiliated Hospital of Zhejiang University School of Medicine. The clinical samples were used for quantitative polymerase chain reaction (qPCR), western blot (WB) and immunohistochemistry (IHC) analyses.
Cell cultures and cell transfection
The glioma cell line U87-MG was purchased from the Cell Library of the Chinese Academy of Sciences (Shanghai, China). U87-MG was maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS, Gibco) and 100 U/ml penicillin-streptomycin (Gibco). For selection of efficient LAMP-2A and N-CoR siRNA, cells were cultured in 6-well plate at density of 5 × 105/ml until confluence of 60–70%. The medium was replaced by Opti-MEM (Invitrogen, Grand Island, NY, USA). The following siRNAs were designed and transfected according to the Lipofectamine 2000 protocol (Lipo2000, Invitrogen): Negative control of LAMP-2A, 5'→3'-UUCUCCGAACGUGUCACGU; LAMP-2A siRNA1, 5'→3'-CUGGGAUGUUCUUGUACAA; LAMP-2A siRNA2, 5'→3'-GCUCUACUUAGACUCAAUA; LAMP-2A siRNA 3, 5'→3'-GCCUUGGGCUUCCUUAUAA; Negative control of N-CoR, 5'→3'- UUCUCCGAACGUGUCACGU; N-CoR siRNA1, 5'→3'- GACGAGUCAAGUUCAUUAA; N-CoR siRNA2, 5'→3'- GACCCUAUGAAAGUGUAUA; LAMP-2A siRNA 3, 5'→3'- CCUCGUCAGAAGGAAUUAU. The cells were harvested after 72 h post-transfection for mRNA quantification. The siRNA with best inhibitory effect was utilized for in vitro study and constructing LAMP-2A shRNA lentivirus.
Constructing Lentivirus-mediated LAMP-2A shRNA
The pLKO.1-shLAMP-2A and control plasmid were designed and cloned, together with package plasmids including psPAX2 and PMD2G. These lentivirus-based constructs were co-transfected into cultured 293T cells. The replication-deficient lentiviral particles were packaged and collected 72 hours later for in vivo study.
Nude mouse xenograft studies
The study was approved by the Institutional Animal Care and Use Committee of The Second Affiliated Hospital of Zhejiang University, School of Medicine. The male BALB/c nude mice (average weight 20 g; 6–8 weeks old) were purchased from Experimental Animal Laboratories (SLAC, Shanghai, China). The mice were cultivated in a specific pathogen-free room at 20 °C under a 14 h light/10 h dark cycle with free access to food and water. Nine mice were randomly subdivide into three groups: vehicle group was injected with normal U87-MG cells; negative control group was injected with U87-MG cells transfected with control virus; LAMP-2A shRNA group was injected with U87-MG cells transfected with LMAP-2A shRNA virus. The allocation process was blinded to the researcher. Mice were injected subcutaneously under the axillary with treated U87-MG cells at a density of 1 × 107 and the tumor volume (mm3, = length × width × height × 0.5236) were calculated from day 12 until day 30. All mice were sacrificed by intraperitoneal injection of 100 mg/kg of barbiturate and the tumor tissues were harvested as a whole to obtain weight before being cryopreserved for further analysis.
Quantitative real-time RT-PCR
Total RNA from cultured cells was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was generated by 1 µg RNA using the RevertAid First Strand cDNA Synthesis Kit (MBI Fermentas, Burlington, Canada).
Quantitative real-time RT-PCR (qRT-PCR) was carried out with the Power SYBR Green Master Mix (Thermo Fisher Scientific, Wilmington, DE, USA) on ABI 7300 real-time quantitative PCR system (Life Technologies, Grand Island, NY) with the following conditions: 95 °C for 10 min, 40 cycles of 95 °C for 15 s, 60 °C for 1 min.The specific primers were list as follows: LAMP-2A, forward 5'CAATAGCAGCACCATTAAG3', reverse 5'GGAGCCATTAACCAAATAC3; N-CoR, forward 5'AGGCGACACAATCTTGAC3', reverse 5' TGGAAGCGACACTTTCAC 3'; β-actin as internal reference, forward 5' CATCGTCCACCGCAAATGCTTC 3', reverse 5' AACCGACTGCTGTCACCTTCAC 3'. Results were analyzed using the 2−∆∆C method.
Western blot
After various treatment, brain tissues or cell lysates were prepared with immunoprecipitation assay (RIAP) lysis buffer (solarbio, Dalian, China). BCA kit (Thermo Fisher Scientific, Wilmington, DE, USA) was applied to measure the protein concentrations. The lysates containing 40 µg of protein were subjected to SDS-PAGE and transferred to nitrocellulose filter membrane (Millipore, Bedford, MA, USA). After blocking with 10% bovine serum albumin at room temperature for 1 h, the membranes were incubated overnight at 4 °C with primary antibodies as follows: LAMP-2A(1:1000, Abcam, Cambridge, UK), N-CoR (1:500, Abcam), p-PERK (1:300, Santa Cruz, CA, USA), p-IRE1 (1:2000, Abcam), p-JNK1/2 (1:1000, Abcam), CHOP (1:1000, Abcam), Bcl-2 (1:300, Santa), Bax (1:300, Santa Cruz), Caspase-3(1:500, Abcam), Caspase-9 (1:1000, Abcam), GAPDH (1:2000, Cell Signaling Technology, Beverly, MA) and β-actin(1:1000, CST). Then the membranes were probed with horseradish peroxidase labeled secondary antibody (goat anti-rabbit, donkey anti-goat, goat anti-mouse, 1:1000, Beyotime, Shanghai, China), and visualized with electrochemiluminescence). The bands were quantified by Image software (ImageJ) from National Institutes of Health (http://rsb.info.nih.gov/ij/download.html).
Immunohistochemistry staining
Immunohistochemistry was performed with LAMP-2A (1:100, Abcam, UK), N-CoR (1:100, Santa Cruz) for cells and N-CoR (1:100, Novus, CO, US) for tissues. After being equilibrated at -20 °C for 15 min, brain tumor tissues were sectioned at a range of 5–7 µm and fixed with 4 °C pre-cold acetone. Cultured cells growing on glass slides were fixed with 4% of formaldehyde. The tissue or cell sections were incubated with 3% of H2O2 for 10 min, followed by 10% of BSA as blocking solution for 1 h at room temperature. Then the sections were incubated with the primary antibodies overnight at 4 °C and hybridized with horseradish peroxidase labeled secondary antibody (Beyotime, China) for 1 h at room temperature. The diaminobenzidine kit (DAB kit; Long Island Biotec, Shanghai, China) was applied for visualization and hematoxylin (BASO, China) for counterstain.
Immunofluorescence staining
The brain tissue and cell sections were prepared. After permeabilization with 0.3% Triton X-100 (Sigma-Aldrich), sections were probed with LAMP-2A (1:100, Abcam), N-CoR (1:100, Novus) for tissues or N-CoR (1:100, Santa Cruz) for cells. After being washed with PBS containing 0.05% of Tween-20 (Sigma-Aldrich), sections were incubated with fluorescent secondary antibodies (Beyotime, China) and antifade mounting medium containing 1:500 DAPI (Beyotime, China). Leica fluorescent microscope was used for visualization.
Co-Immunoprecipitation (Co-IP)
Cultured U87-MG cells were lysed in lysis buffer (20 mM pH 7.5 Tris, 150 mM NaCl, 1% TritonX-100, 1 mM EDTA and protease inhibitor cocktail). The lysates were cleared by centrifugation and subsequently incubated with either 20 µg of IgG or 2 µg of LAMP-2A antibody for 2 h with rotation on ice. Protein G-Agarose beads (Roche, Mannheim, Germany) were then added followed by overnight rotation at 4 °C. Immunoprecipitants were separated on SDS-PAGE gel. LAMP-2A(1:1000, Abcam) and N-CoR (1:500, Abcam) were detected by western blotting as previously mentioned.
Terminal deoxynucleotidyl transfer-mediated dUTP nick end labeling (TUNEL)
Cultured cells growing on glass slides were fixed with 4% of formaldehyde. After permeabilization with 0.3% Triton X-100 (Sigma-Aldrich), apoptotic cells were detected according to the manufacturer’s protocol of TUNEL kit (Roche).
Flow cytometry detection of apoptosis
Cultured cells growing on 6-well plate with various treatment were digested. Apoptosis was measured by the Annexin V-fluorescein isothiocyanate apoptosis kit (Beyotime, China) according to the manufacturer’s protocol. The results were analyzed with a FACS Calibur flow cytometer (BD Biosciences).