Ablation of Hypoxia-induced mitogenic factor promotes cardiac repair after myocardial infarction by downregulating matrix metalloproteinase-9 expression in macrophage

doi:10.21203/rs.3.rs-887694/v1

Download PDF

Research Article

Ablation of Hypoxia-induced mitogenic factor promotes cardiac repair after myocardial infarction by downregulating matrix metalloproteinase-9 expression in macrophage

https://doi.org/10.21203/rs.3.rs-887694/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objectives

Matrix metalloproteinase-9 (MMP9) functions as a collagenase, it promotes the infarct expansion and cardiac rupture after myocardial infarction (MI). This study sought to identify the mechanism mediating MI-induced MMP9 expression, and explore the new therapeutic target improving healing process after MI.

Materials and Methods

HIMF expression is manipulated by genetic ablation of HIMF in mice (Himf^−/−), and adenoviral overexpression of HIMF by recombinant adenovirus encoding a green fluorescent protein (GFP)-tagged mouse HIMF in cultured neonatal rat ventricular myocytes (NRVMs), cardiac fibroblasts (CFs) and the murine macrophage RAW264.7 cells. The mouse model of left descending coronary artery ligation was established to investigate the expression of MMP9 and HIMF.

Results

MMP9 was predominantly expressed in macrophages of MI hearts, and positively correlated to the expression of HIMF, a marker for anti-inflammatory macrophage polarization. HIMF deficiency (Himf^−/−) results in significantly decreased MMP9 expression, increased collagen deposition, reduced infarction size and improved cardiac contraction. Mechanistic analysis reveals that HIMF increases MMP9 expression by activating STAT3 signaling in murine macrophage RAW264.7. This was verified by the inhibited STAT3 phosphorylation in the MI heart of Himf^−/− mouse.

Conclusions

This study identified a novel HIMF-STAT3-MMP9 regulation module in macrophages that influences collagen deposition in infarct heart, providing a new sight for MI treatment.

Cardiac & Cardiovascular Systems

Cardiothoracic Surgery

Biotechnology and Bioengineering

Immunology

Hypoxia-induced mitogenic factor

Matrix metalloproteinase-9

myocardial infarction

macrophages

collagen deposition

Adverse left ventricular (LV) remodeling constitutes the structural basis for the progression from myocardial infarction (MI) to ischemic heart failure (HF) [1]. Improper cardiac repair is a major determinant of this process. It involves insufficient deposition of extracellular matrix (ECM), which jeopardizes the infarct restriction and scar formation [2]. Also, the ECM insufficiency greatly increases cardiac vulnerability to rupture, an acute lethal complication frequently occurred in a few days post MI [3]. Collagens represent over 95% of protein components in ECM. The balance between collagen degradation and production decides if adequate ECM could be utilized for post-MI healing [2, 4]. This relies largely on the expression and activity of matrix metalloproteinases (MMPs), the well-known collagenases contributing to ECM loss after MI [5, 6]. MI triggers increased expression and activities of MMPs [7]. Administrating a broad-spectrum MMP inhibitor attenuates MI-induced LV enlargement [8], suggesting the detrimental effect of increased MMPs on MI wound healing. Specifically, MMP9, one of the abundantly expressed MMP members in MI heart, has been associated with rupture-related mortality and infarct expansion. Such as ablation of MMP9 expression in mice decreases cardiac rupture events after MI [9, 10], and reduces infarct size after ischemia/reperfusion injury in hearts [11]. Besides, MMP9 dynamically regulates MI inflammatory response, whereby MMP9 promotes interleukin-1β release, which stimulates intensive inflammation and involves in pyroptosis [6, 12]. However, though the critical role of MMP9 upregulation in the development of cardiac ischemic injury has been well recognized, the mechanism regulating MMP9 expression under MI background remains largely unknown.

Macrophage is a main source of MMP9 and an important orchestrator for inflammation response to MI [13, 14]. The initial ischemic stress triggers infiltration of neutrophils and monocytes. Then the macrophages differentiated from monocytes are rapidly deployed to inflammation sites. Accumulating evidence shows that macrophages produce pro- and anti-inflammatory cytokines/chemokines in succession, to promote inflammation and tissue repair, respectively [15, 16]. The exaggerated proinflammatory activity of macrophage leads to sustained tissue damage, insufficient healing and contractile dysfunction [1]. Interestingly, the differentiation of monocytes to proinflammatory macrophages greatly increases expression of MMP9, which may enhance the inflammatory response and induces excessive ECM digestion, exaggerating tissue damage.

HIMF (hypoxia-induced mitogenic factor) is a cysteine-rich protein belonging to a family of small secreted proteins [17]. It is also known as found in inflammatory zone (FIZZ1), and has been identified as a marker highly inducible in macrophages [18]. Previous studies have extensively explored the function of HIMF in pulmonary diseases [19]. Our recent work identified pro-hypertrophy and pro-fibrosis functions of HIMF in hearts [20, 21]. Given the pathological effects of HIMF are tightly associated with inflammation [18, 22], we hypothesized that HIMF promotes MMP9 expression in macrophages in MI hearts, exaggerating cardiac ischemic injury by promoting collagen degradation and inflammatory response. Therefore, in this study, we investigated the causal relationship between HIMF and MMP9 expression in the context of MI and their contribution to heart injury by using HIMF depletion mice (Himf^−/−). The possible mechanism underlying HIMF regulation of MMP9 and collagen deposition was further investigated in murine macrophage RAW264.7.

2.1 Experimental Animals

C57BL/6J mice were obtained from the Animal Center of Guangdong Province, China, and raised under pathogen-free conditions with free access to food and water. All animal protocols were approved by the Institutional Care and Ethical Committee of Shenzhen University and followed the procedures outlined in the Guide for the Care and Use of Laboratory Animals (National Institutes of Health publication No.85 − 23, revised 1996). HIMF knockout mice (Himf^−/− on a C57BL/6J background), were generated using a CRISP/Cas9 system by Nanjing Biomedical Research Institute of Nanjing University, China, as previously described [20]. All four exons of HIMF gene were deleted. For genotyping, the primer pair 5’-GTGCTGATGCTGACTGTA − 3’ and 5’- GATGACACTGCTTCCATAAG − 3’ was used to identify the HIMF allele (504 bp); and the primer pair 5’- CTCTTGAACCACACCTCTT − 3’ and 5’- CTAACCAGGCATCTCACAT-3’ was used to identify the Himf^−/− allele (239 bp).

2.2 Myocardial infarction model

Male C57BL/6J mice weighing 20 to 24 g were divided into two groups. Mice in the sham operation group were given thoracotomy without ligation of coronary artery, while mice in the myocardial infarction group were given thoracotomy with permanent ligation of the left anterior descending coronary artery (LAD). After administration of pentobarbital sodium (3%) to mice in the myocardial infarction group under anesthesia, the mice were intubated and mechanically ventilated (100 strokes/min, 250 µL stroke volume, Hugo Sachs Elektronik- Harvard Apparatus). The skin was cut between the 3rd and 4th intercostals along the intercostal space on the left side of the sternum. The subcutaneous tissue and muscle were separated layer by layer to expose the heart. The LAD was ligated with a 7 − 0 silk suture at a depth of 1 mm and a width of 1-1.5 mm. After ligation, the left ventricular wall turned pale, and the ventricular wall motion decreased, suggesting a successful ligation. The chest and skin were then closed in layers with a 7 − 0 nylon suture and the air was removed from the thorax with a pleural catheter, followed by subcutaneous injection of 0.2 ml 0.9% saline for rehydration.

2.3 Echocardiography

A Vevo 2100 system was used to perform echocardiography (Visual Sonics, Toronto, Ontario, Canada) for mice anesthetized with 1.0% isoflurane. The heart image was captured in the two-dimensional (2-D) mode under the parasternal short-axis view. M-mode tracings were recorded at the papillary muscle level to obtain the following parameters: left ventricular internal dimensions at diastole (LVIDd) and systole (LVIDs), left ventricular posterior wall dimensions at diastole (LVPWd) and systole (LVPWs), left ventricular fractional shortening (FS) and ejection fraction (EF).

2.4 Masson trichrome Staining, picrosirius red Staining and Immunofluorescence staining

Paraffin sections of infarcted hearts were prepared by routine paraffin embedding method, and sectioned at 5 µm intervals from the position of ligation to the heart apex. To assess the infarct extent, the paraffin sections were stained with Masson trichrome (Cat#G1345, Solarbio, Beijing, China) following the manufacturer’s protocol. The percentage of the blue stained area versus the total area was used to indicate the extent of the infarction. To assess the collagen deposition, three paraffin sections per heart containing the infarct region were randomly selected and stained with picrosirius red (Cat#36324ES60, Yeasen, shanghai, China) following the manufacturer’s protocol. The percentage of the red stained area versus the total area was applied and used to indicate the collagen density.

To examine the relationship between MMP9 and macrophages in the infarcted myocardium, we conducted dual-immunofluorescence staining on paraffin sections. Briefly, after routine hydration, the heart sections were microwaved for 3 min in citrate buffer (0.4 g/L citric acid and 3 g/L sodium citrate) for antigen retrieval. Permeabilization and blocking was performed in PBS with 5% bovine serum albumin (BSA) and 0.2% Triton X-100, at room temperature for 30 min. The sections were incubated overnight at 4°C with anti-CD68 (Cat#NBP-33337, Novus, CO, USA) and anti-MMP9 (Cat#10375-2-AP, Proteintech, IL, USA) and incubated for 1 h at 30°C with the following secondary antibodies: A-21050 (1:400), A-11010 (1:400) (Invitrogen, Carlsbad, CA) and 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, Cat# 10236276001, Sigma-Aldrich, Burlington, MA, USA). The Zeiss LSM880 microscope (Carl Zeiss, Germany) was used to capture confocal images and the Image-J software (NIH, USA) was used to perform data analysis.

2.5 Cell culture

The murine macrophage RAW264.7 cells (Cell Bank of Chinese Academy of Sciences,Shanghai, China) were amplified though passaging and cultured in complete DMEM (supplemented with 10% FBS and 1% penicillin/streptomycin) medium in plates. To achieve HIMF over-expression, the recombinant adenovirus encoding a green fluorescent protein (GFP)-tagged mouse HIMF (MOI-30) (Ad-HIMF; Weizhen Biotech, Shandong, China) was administrated 48h, a recombinant adenovirus expressing GFP (Ad-GFP) was used as control. To inhibit STAT3 activity, 50 µM STAT3 specific inhibitor S3I-201 (Cat# HY-15146, MCE, Monmouth Junction, NJ, USA) was administrated 8 h before ad-HIMF/ad-GFP adenoviral infection. Equal amounts of DMSO were added as carrier controls. Neonatal rat cardiomyocytes (NRVMs) and cardiac fibroblasts (CFs) were isolated from 1-2-day-old Sprague-Dawley rats as previously described [23].

2.6 RNA reverse transcription and gene expression analysis

Total RNA was isolated from the hearts of mice or macrophages using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was generated following the manufacturer’s protocol (Cat# AU311, TransGen, Beijing, China). mRNA expression was assayed using ChamQ Universal SYBR qPCR master mix underwent real-time PCR. Each sample was examined in triplicate and the relative mRNA expression level was calculated using 2 − ΔΔCt method. The customized primers were applied for mouse GAPDH: forward 5’-GGTTGTCTCCTGCGACTTCA-3’, reverse 5’- TGGTCCAGGGTTTCTTACTCC-3’; mouse MMP9: forward 5’- CCAGCCGACTTTTGTGGTCT-3’, reverse 5’- TGGCCTTTAGTGTCTGGCTG-3’; mouse MMP2: forward 5’-GGACAGTGACACCACGTGAC-3’, reverse 5’-ACTCATTCCCTGCGAAGAACA-3’; and mouse TIMP4: forward 5’-GCCAAGGATATTCAGTATGTC3’, reverse 5’- GCACAGATGGATGAAGACT.

2.7 Western blot analysis

Protein was isolated from the hearts of mice or lysed macrophages and separated by SDS-PAGE, then electrotransferred onto a polyvinylidene difluoride (PVDF) membrane (Merck Millipore, Bedford, MA, USA), blocked in 5% BSA for 1 h at room temperature, and incubated at 4 ℃ overnight with primary antibodies for HIMF (1:500, Cat#ab39626, Abcam, Cambridge, UK), MMP9 (1:1000, Cat#10375-2-AP, proteintech, IL, USA), P-STAT3 (1:1000, Cat#9145T, Cell Signaling Technology, Danvers, MA), STAT3 (1:1000, Cat#4904T, Cell Signaling Technology, Danvers, MA), β-Tublin (1:1000, Cat#YM3030, ImmunoWay, TX, USA), LMNB1 (1:1000, Cat#YT5180, ImmunoWay, TX, USA), GAPDH (1:10000, Cat#2118S, Cell Signaling Technology, Danvers, MA). After being washed in TBS-T 3 times for 10 min, membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (anit-Rabbit Cat#7074 or anti-Mouse Cat#7076, Cell Signaling Technology, Danvers, MA) for 1 h and visualized using a UVP ChemStudio PLUS imaging system (CA, USA). To analyze protein phosphorylation, the membrane were stripped with Restore Western Blot Stripping Buffer (Thermo Scientific, Rockford, IL) and subsequently re-incubated with primary antibodies targeting the same position. Relative protein expression quantification was performed with Image-J software (NIH, USA).

2.8 Statistical analysis

Statistical analysis were performed using GraphPad Prism 5 software (CA, USA), and the results are presented as means ± standard error of mean. A Student’s t test was used for comparisons between data collected from two groups. A one-way ANOVA or two-way ANOVA was used to analyze data collected from more than two groups or two groups and ≥ 2 time points/treatments. Differences were considered statistically significant if P < 0.05.

3.1 HIMF deficiency effectively increased the collagen deposition and restricted infarct expansion.

MI was introduced by left descending coronary artery ligation in WT and Himf^−/−mice (under C57BL6 background, 3-month-old). The echocardiography analysis was performed at day 7 post MI to evaluate the early tissue repair outcome. The results show that in comparison with WT MI hearts, the Himf^−/− MI hearts displayed less ventricular dilation indexed by left ventricular internal diameter (LVID) and thicker left ventricular posterior wall (LVPW, Fig. 1A, 1B). Consistently, the left ventricular ejection fraction (EF) and fractional shortening (FS) were significantly higher in Himf^−/−mice. These data suggest that HIMF deficiency improved early LV remodeling and contractile functions after MI (Fig. 1B).

Collagen deposition extent and the infarct size were assessed in transverse sections of these infarct hearts. The picrosirius red (PSR) staining demonstrated that significantly denser collagen fibers were deposited around the infarction region of Himf^−/− than WT hearts (Fig. 1C). While the masson trichrome staining demonstrated that the infarct region in Himf^−/− hearts was smaller than WT (Fig. 1D), suggesting that the increased collagen deposition effectively restricted the infarct expansion in Himf^−/− hearts.

3.2 MMP9 upregulation in macrophages post MI is prohibited by HIMF ablation.

In parallel to the increase of HIMF expression, we found MMP9 mRNA level was upregulated in MI LV tissues in both inflammation phase (3 days post MI) and reparative phase (7 days post MI, Fig. 2A). In contrast, the mRNA level of MMP2 and TIMP4, the two other MMP members participating collagen degradation remain unaltered. HIMF deficiency significantly decreased MMP9 mRNA levels. Consistently, MMP9 protein levels were significantly increased in MI heart tissue at day 7 post MI and HIMF deficiency abolished this response (Fig. 2B). The results suggest the HIMF is an upstream regulator of MMP9 expression.

To analyze the contribution of macrophages in MMP9 expression, we co-immunostained CD68 (macrophage marker) and MMP9 proteins in the MI heart sections. Figure 2C clearly shows the colocalization of CD68 and MMP9, suggesting macrophage is the major source of MMP9 in the infarct region. Furthermore, we isolated macrophages from infarct hearts at day 7 post MI according to the flow cytometry gating strategy CD45⁺CD11b⁺F4/80⁺Ly6G⁻, and compared the MMP9 mRNA level between WT and Himf^−/− macrophages. The data verified that MMP9 expression was significantly inhibited in macrophages of Himf^−/− hearts after MI (Fig. 2D).

3.3 HIMF upregulates MMP9 expression in macrophages, but not cardiomyocytes and cardiac fibroblasts.

Our previous studies have identified dynamic roles of HIMF in cardiomyocytes (NRVMs) [20], and its paracrine effect on cardiac fibroblasts (CFs) [21]. To clarify if HIMF also regulate MMP9 expression in these two major cell types in heart, we isolate cardiomyocytes and CFs from 1-2-day-old Sprague-Dawley rats, and infected them with adenovirus overexpressing either HIMF (ad-HIMF) or GFP (ad-GFP). Interestingly, unlike the up-regulated expression of MMP9 in ad-HIMF infected macrophages (Fig. 3A, 3B), no significant increase of MMP9 expression was observed in either ad-HIMF infected CFs or NRVMs, despite HIMF protein expressions were significantly increased (Fig. 3C-F). These findings confirm macrophage is the major source of MMP9 expression upon HIMF stimulation.

3.4 STAT3 mediates HIMF-activation of MMP9 in macrophages.

We next investigated the mechanism underlying HIMF upregulation of MMP9 expression. Studies have suggested that Signal Transducer of Activator of Transcription 3 (STAT3) servers as a transcriptional activator for MMP9 expression, and the involvement of STAT3 in ECM production and detachment has been reported [24, 25]. In the context of HIMF-stimulated inflammatory response, STAT3 can be activated. We thus hypothesized that STAT3 is activated and mediates MMP9 expression by HIMF in macrophages. To test this hypothesis, we compared STAT3 phosphorylation levels in RAW264.7 macrophages overexpressing HIMF or GFP. As shown in Fig. 4A, HIMF overexpression in macrophages enhanced STAT3 phosphorylation by approximately 50% as compared with GFP control. In accordance with the in vitro finding, we found the phosphorylation of STAT3 in the heart tissue of Himf^−/− mice is lower than that of WT at 7 days post MI (Fig. 4B). Additionally, a higher level of STAT3 protein was identified in nucleus upon HIMF expression (Fig. 4C), indicating a favored transportation of STAT3 protein into the nucleus for subsequent transcriptional regulation.

To verify the causal relationship between STAT3 activation and MMP9 expression, we examined the effect of inhibition of STAT3 on MMP9 expression in HIMF-overexpressed cells. The result shows that pre-treatment of the cells overexpressing HIMF with STAT3 inhibitor S3I-201 inhibited STAT3 activation and consequently decreased MMP9 expression (Fig. 4D), supporting a role of STAT3 in mediating HIMF induced expression of MMP9 in macrophages.

Expression of MMP9 in macrophages contributes to insufficient ECM deposition and unrestricted inflammation after MI. This would lead to enhanced and prolonged inflammatory response and improperly initiated ventricular remodeling. Hence inhibition of MMP9 has emerged as a potential therapeutic strategy for MI-induced adverse LV remodeling. However, it has been reported that a ubiquitous knockout of MMP9 in mice (MMP-9 KO mice) resulted in an unexpected reduction of collagen accumulation in the infarcted area of heart than did WT mice, due to complementarily enhanced expression of MMP-2, MMP-13, and TIMP-1 and decreased macrophage number [10]. Thus, alternative strategies inhibiting MMP9 are urgent. In this study, we found a novel regulating mechanism of MMP9 expression in macrophages involving HIMF and HIMF-induced activation of STAT3 during MI (Fig. 5). Of particular interest, this regulation is unique in macrophages, but not in other major cell types in heart including cardiomyocytes and cardiac fibroblasts. Ablation of HIMF decreased MMP9 expression without changing the expression of other MMP members and macrophage number in infarcted area, and thus promoted ECM deposition and cardiac function after MI. Therefore, the present findings provide a hopeful therapeutic strategy for the treatment of adverse LV remodeling post MI.

MMP9, though well known as a collagenase, was considered a multifunctional protein. It was reported to promote the inflammatory response during MI via activating the expression of inflammatory cytokines and chemokines in macrophage [26, 27]. MMP9 was also found to enhance cardiac oxidative stress and promote pyroptosis [12]. Therefore, MMP9 may exert integrative effect on the healing process of ischemic injury in addition to regulating ECM degradation. Of note, HIMF expression level was also reported to be associated with inflammatory response [22, 28, 29], and multiple healing-related functions such as angiogenesis or energy balance maintaining [19, 22]. It would be of interest to investigate the possible contribution of MMP9 in these properties of HIMF in the wound healing process in the context of MI.

It has been proved that STAT3 is an effective activator of MMP9 expression [30, 31]. Here we found that HIMF expression activated STAT3 by stimulating phosphorylation and nucleus-transportation of STAT3 in macrophages, and inhibition of STAT3 activity suppressed HIMF-upregulation of MMP9 in macrophage. These data supported that HIMF exert its effect on MMP9 expression through enhancing STAT3 transcriptional activity. However, in contrast to the observation that HIMF-MMP9 regulation axis is specific to macrophage, we previously observed an induced STAT3 phosphorylation in cardiomyocytes upon HIMF expression [21], claiming this event is not specific. Thus, the next intriguing question is whether there are other cooperative factors restricting the HIMF-regulation of MMP9 in the macrophages. Finding answer to this question would help to pinpoint the distinct role of HIMF in macrophage, and provide new clues to achieve inhibition of MMP9 in specific cell type with therapeutic purpose for certain cardiac disease.

In conclusion, this study reveals that HIMF is a critical regulator of MMP9 expression in the macrophage hearts in MI, the ablation of HIMF expression inhibits MMP9 mediated collagen degradation, and hence reduced infarction size and improved cardiac contraction.

MMP9

Matrix metalloproteinase-9

Myocardial infarction

HIMF

Hypoxia-Induced Mitogenic Factor

Left ventricular

Heart failure

ECM

Extracellular matrix

MMPs

Matrix metalloproteinases

FIZZ1

Found in inflammatory zone

LVID

Left ventricular internal diameter

LVPW

Left ventricular posterior wall

Ejection fraction

Fractional shortening

PSR

Picrosirius red

MMP2

Matrix metalloproteinase-2

MMP-13

Matrix metalloproteinase-13

TIMP-1

TIMP metallopeptidase inhibitor-1

TIMP-4

TIMP metallopeptidase inhibitor-4

NRVM

Neonatal rat cardiomyocyte

Cardiac fibroblast

ad-HIMF

Adenovirus overexpressing HIMF

ad-GFP

Adenovirus overexpressing GFP

STAT3

Signal Transducer of Activator of Transcription 3

Author contributions

Wenjuan Liu and Jie Liu designed this program. Li Feng and Qing Wang conducted the cell experiments, Qing Wang, Yanjiao Li and Wanwen Cheng accomplished animal experiments. Li Feng, Qing Wang and Yanjiao Li completed the data collection and analysis. Wenjuan Liu and Yanjiao Li wrote the manuscript which was reviewed by Li Feng and Jie Liu.

Declaration of competing interest

The authors declare that they have no conflict of interest with this article.

Availability of data and materials

The datasets used and/or analysed during the current study are available from Qing Wang on reasonable request.

Acknowledgements

Not applicable.

Funding

This work was supported by grants from National Natural Science Foundation of China Grants (grants 31671179, 81970250 and 82070340). Basic Research Foundation of Shenzhen (grant 20200812105703001, 20200812105703001 and JCYJ20190808123018993). Shenzhen Key Laboratory of Metabolism and Cardiovascular Homeostasis (grant ZDSYS20190902092903237). The Natural Science Foundation of Guangdong Province (grant 2020A1515010259 and 2018A030310456). The SZU Top Ranking Project (grant 86000000210), and the SZU Medical Young Scientists Program (grant 71201-000001).

Prabhu SD, Frangogiannis NG (2016) The Biological Basis for Cardiac Repair After Myocardial Infarction: From Inflammation to Fibrosis. Circ Res 119:91–112. http://dx.doi.org/10.1161/CIRCRESAHA.116.303577
Van Aelst LN, Voss S, Carai P, Van Leeuwen R, Vanhoutte D, Sanders-van Wijk S et al (2015) Osteoglycin prevents cardiac dilatation and dysfunction after myocardial infarction through infarct collagen strengthening. Circ Res 116:425–436. http://dx.doi.org/10.1161/CIRCRESAHA.116.304599
Nawaito SA, Sahadevan P, Clavet-Lanthier ME, Pouliot P, Sahmi F, Shi Y et al (2019) MK5 haplodeficiency decreases collagen deposition and scar size during post-myocardial infarction wound repair. Am J Physiol Heart Circ Physiol 316:H1281–H1296. http://dx.doi.org/10.1152/ajpheart.00532.2017
Samouillan V, Revuelta-Lopez E, Soler-Botija C, Dandurand J, Benitez-Amaro A, Nasarre L et al (2017) Conformational and thermal characterization of left ventricle remodeling post-myocardial infarction. Biochim Biophys Acta Mol Basis Dis 1863:1500–1509. http://dx.doi.org/10.1016/j.bbadis.2017.02.025
Hayashidani S, Tsutsui H, Ikeuchi M, Shiomi T, Matsusaka H, Kubota T et al (2003) Targeted deletion of MMP-2 attenuates early LV rupture and late remodeling after experimental myocardial infarction. Am J Physiol Heart Circ Physiol 285:H1229–H1235. http://dx.doi.org/10.1152/ajpheart.00207.2003
Liberale L, Bonaventura A, Montecucco F. T-cells in myocardial infarction: Culprit instigators or mere effectors? World J Cardiol.10(2018)
123-6
. http://dx.doi.org/10.4330/wjc.v10.i10.123
Montecucco F, Liberale L, Bonaventura A, Vecchie A, Dallegri F, Carbone F (2017) The Role of Inflammation in Cardiovascular Outcome. Curr Atheroscler Rep 19:11. http://dx.doi.org/10.1007/s11883-017-0646-1
Liao YH, Cheng X. Autoimmunity in myocardial infarction. Int J Cardiol.112(2006)21 – 6. http://dx.doi.org/10.1016/j.ijcard.2006.05.009
Heymans S, Luttun A, Nuyens D, Theilmeier G, Creemers E, Moons L et al (1999) Inhibition of plasminogen activators or matrix metalloproteinases prevents cardiac rupture but impairs therapeutic angiogenesis and causes cardiac failure. Nat Med 5:1135–1142. http://dx.doi.org/10.1038/13459
Ducharme A, Frantz S, Aikawa M, Rabkin E, Lindsey M, Rohde LE et al (2000) Targeted deletion of matrix metalloproteinase-9 attenuates left ventricular enlargement and collagen accumulation after experimental myocardial infarction. J Clin Invest 106:55–62. http://dx.doi.org/10.1172/JCI8768
Romanic AM, Harrison SM, Bao W, Burns-Kurtis CL, Pickering S, Gu J et al. Myocardial protection from ischemia/reperfusion injury by targeted deletion of matrix metalloproteinase-9. Cardiovasc Res.54(2002)549 – 58. http://dx.doi.org/10.1016/s0008-6363(02)00254-7
Yadav SK, Kambis TN, Kar S, Park SY, Mishra PK (2020) MMP9 mediates acute hyperglycemia-induced human cardiac stem cell death by upregulating apoptosis and pyroptosis in vitro. Cell Death Dis 11:186. http://dx.doi.org/10.1038/s41419-020-2367-6
Newby AC (2016) Metalloproteinase production from macrophages - a perfect storm leading to atherosclerotic plaque rupture and myocardial infarction. Exp Physiol 101:1327–1337. http://dx.doi.org/10.1113/EP085567
Nahrendorf M, Pittet MJ, Swirski FK (2010) Monocytes: protagonists of infarct inflammation and repair after myocardial infarction. Circulation 121:2437–2445. http://dx.doi.org/10.1161/CIRCULATIONAHA.109.916346
Cao DJ, Schiattarella GG, Villalobos E, Jiang N, May HI, Li T et al (2018) Cytosolic DNA Sensing Promotes Macrophage Transformation and Governs Myocardial Ischemic Injury. Circulation 137:2613–2634. http://dx.doi.org/10.1161/CIRCULATIONAHA.117.031046
Courties G, Heidt T, Sebas M, Iwamoto Y, Jeon D, Truelove J et al (2014) In vivo silencing of the transcription factor IRF5 reprograms the macrophage phenotype and improves infarct healing. J Am Coll Cardiol 63:1556–1566. http://dx.doi.org/10.1016/j.jacc.2013.11.023
Steppan CM, Brown EJ, Wright CM, Bhat S, Banerjee RR, Dai CY et al (2001) A family of tissue-specific resistin-like molecules. Proc Natl Acad Sci USA 98:502–506. http://dx.doi.org/10.1073/pnas.98.2.502
Iwata A, Kawashima S, Kobayashi M, Okubo A, Kawashima H, Suto A et al. Th2-type inflammation instructs inflammatory dendritic cells to induce airway hyperreactivity. Int Immunol.26(2014)103 – 14. http://dx.doi.org/10.1093/intimm/dxt047
Teng X, Li D, Champion HC, Johns RA. FIZZ1/RELMalpha, a novel hypoxia-induced mitogenic factor in lung with vasoconstrictive and angiogenic properties. Circulation research.92(2003)1065-7. http://dx.doi.org/10.1161/01.res.0000073999.07698.33
Kumar S, Wang G, Liu W, Ding W, Dong M, Zheng N et al. Hypoxia-Induced Mitogenic Factor Promotes Cardiac Hypertrophy via Calcium-Dependent and Hypoxia-Inducible Factor-1alpha Mechanisms. Hypertension.72(2018)331 – 42. http://dx.doi.org/10.1161/HYPERTENSIONAHA.118.10845
Kumar S, Wang G, Zheng N, Cheng W, Ouyang K, Lin H et al. HIMF (Hypoxia-Induced Mitogenic Factor)-IL (Interleukin)-6 Signaling Mediates Cardiomyocyte-Fibroblast Crosstalk to Promote Cardiac Hypertrophy and Fibrosis. Hypertension.73(2019)1058-70. http://dx.doi.org/10.1161/hypertensionaha.118.12267
Kumamoto Y, Camporez JPG, Jurczak MJ, Shanabrough M, Horvath T, Shulman GI et al. CD301b(+) Mononuclear Phagocytes Maintain Positive Energy Balance through Secretion of Resistin-like Molecule Alpha. Immunity.45(2016)583 – 96. http://dx.doi.org/10.1016/j.immuni.2016.08.002
Liu W, Deng J, Xu J, Wang H, Yuan M, Liu N et al. High-mobility group box 1 (HMGB1) downregulates cardiac transient outward potassium current (Ito) through downregulation of Kv4.2 and Kv4.3 channel transcripts and proteins. J Mol Cell Cardiol.49(2010)438 – 48. http://dx.doi.org/10.1016/j.yjmcc.2010.05.004
Brown CW, Amante JJ, Goel HL, Mercurio AM (2017) The alpha6beta4 integrin promotes resistance to ferroptosis. J Cell Biol 216:4287–4297. http://dx.doi.org/10.1083/jcb.201701136
Ray S, Ju X, Sun H, Finnerty CC, Herndon DN, Brasier AR (2013) The IL-6 trans-signaling-STAT3 pathway mediates ECM and cellular proliferation in fibroblasts from hypertrophic scar. J Invest Dermatol 133:1212–1220. http://dx.doi.org/10.1038/jid.2012.499
Esnault S, Kelly EA, Johnson SH, DeLain LP, Haedt MJ, Noll AL et al. Matrix Metalloproteinase-9-Dependent Release of IL-1beta by Human Eosinophils. Mediators Inflamm.2019(2019)7479107. http://dx.doi.org/10.1155/2019/7479107
Angelini G, Flego D, Vinci R, Pedicino D, Trotta F, Ruggio A et al (2018) Matrix metalloproteinase-9 might affect adaptive immunity in non-ST segment elevation acute coronary syndromes by increasing CD31 cleavage on CD4 + T-cells. Eur Heart J 39:1089–1097. http://dx.doi.org/10.1093/eurheartj/ehx684
Osborne LC, Joyce KL, Alenghat T, Sonnenberg GF, Giacomin PR, Du Y et al. Resistin-like molecule alpha promotes pathogenic Th17 cell responses and bacterial-induced intestinal inflammation. Journal of immunology.190(2013)2292 – 300. http://dx.doi.org/10.4049/jimmunol.1200706
Fan C, Meuchel LW, Su Q, Angelini DJ, Zhang A, Cheadle C et al. Resistin-Like Molecule alpha in Allergen-Induced Pulmonary Vascular Remodeling. American journal of respiratory cell and molecular biology.53(2015)303 – 13. http://dx.doi.org/10.1165/rcmb.2014-0322OC
Zhang M, Xue Y, Chen H, Meng L, Chen B, Gong H et al (2019) Resveratrol Inhibits MMP3 and MMP9 Expression and Secretion by Suppressing TLR4/NF-kappaB/STAT3 Activation in Ox-LDL-Treated HUVECs. Oxid Med Cell Longev 2019:9013169. http://dx.doi.org/10.1155/2019/9013169
Han Y, Guo W, Ren T, Huang Y, Wang S, Liu K et al. Tumor-associated macrophages promote lung metastasis and induce epithelial-mesenchymal transition in osteosarcoma by activating the COX-2/STAT3 axis. Cancer Lett.440–441(2019)116 – 25. http://dx.doi.org/10.1016/j.canlet.2018.10.011

Download PDF

Version 1

posted

You are reading this latest preprint version

Ablation of Hypoxia-induced mitogenic factor promotes cardiac repair after myocardial infarction by downregulating matrix metalloproteinase-9 expression in macrophage

Status:

Version 1

Abstract

Objectives

Materials and Methods

Results

Conclusions

Figures

1. Introduction

2. Materials And Methods

2.1 Experimental Animals

2.2 Myocardial infarction model

2.3 Echocardiography

2.4 Masson trichrome Staining, picrosirius red Staining and Immunofluorescence staining

2.5 Cell culture

2.6 RNA reverse transcription and gene expression analysis

2.7 Western blot analysis

2.8 Statistical analysis

3. Results

3.1 HIMF deficiency effectively increased the collagen deposition and restricted infarct expansion.

3.2 MMP9 upregulation in macrophages post MI is prohibited by HIMF ablation.

3.3 HIMF upregulates MMP9 expression in macrophages, but not cardiomyocytes and cardiac fibroblasts.

3.4 STAT3 mediates HIMF-activation of MMP9 in macrophages.

4. Discussion

5. Conclusions

Abbreviations

Declarations

References

Status:

Version 1