Participants and treatment
Fifty patients with active AIH were recruited at The First People’s Hospital of Changzhou. All patients were diagnosed according to the AIH simplified diagnostic score system proposed by the International Immune Hepatitis Group (IAIHG) in 2008 and the AIH diagnosis and treatment guidelines updated by the American Association for the Study of Liver Diseases (AASLD) in 2010. The experimental protocol conformed to the 1975 Declaration of Helsinki (6th revision, 2008) and is approved by the Ethical Committee of The First People’s Hospital of Changzhou and the Third Affiliated Hospital Soochow University. Informed consent was obtained from each participant.
All patients were randomly divided into the following groups: group I, prednisone treatment, and group II, prednisone + lactobacillus capsule treatment. On days 3 and 7 after treatment, patients’ fecal and blood plasma were collected and subjected to gut microbiota and clinical index analysis.
Establishment of experimental autoimmune hepatitis (EAH) model
Female C57BL/6 mice (6-8 weeks old) were purchased from Nanjing Experimental Animal Center (Jiangsu, China). CD103-deficient (CD103-/-) and MyD88-deficient (MyD88-/-) mice were obtained from The Jackson Laboratory (Bar Harbor, ME). All experiments involved in animal was approved by the Ethical Committee of The First People’s Hospital of Changzhou and the Third Affiliated Hospital of Soochow University.
The EAH model was established as described previously [8, 18]. The effect of lactobacillus capsule treatment on EAH was determined in model mice; the mice were randomly divided into the following groups: group I, sham controls; group II, prednisone (0.5g/kg/day) treatment and group III, prednisone (0.5g/kg/day)+ lactobacillus capsule (0.66g/day) treatment. On day seven after treatment, the fecal, blood plasma, liver tissue, and colon tissue of model mice were collected.
The effect of DCs and MyDD88 in gut microbiota-mediated TFH response in EAH mice was determined in CD103-/- or MyD88-/- mice to mimic the EAH model, then the mice were treated with prednisone (0.5g/kg/day) or prednisone (0.5g/kg/day)+ lactobacillus capsule (0.66g/day).
Real-time quantitative PCR (RT-qPCR) for 16S rRNA
Total DNA from fecal pellets of AIH patients and mice was isolated using the QIAamp Fast DNA stool mini kit (Qiagen) following the manufacturer’s protocol. RT-qPCR primers utilized in the present experiments was as follows: Bacteroides fragilis, forward (5’-3’) TTCAACCTGATCGATCCGGAAGATCCG, reverse (5’-3’) GCTGGTAGACTACCTGAGTAAGGAGTC; Clostridium forward (5’-3’) TTGAGCGATTTACTTCGGTAAAGA, reverse (5’-3’) TGTACTGGCTCACCTTTGATATTCA; Clostridium leptum forward (5’-3’) GCACAAGCAGTGGAGT, reverse (5’-3’) CTTCCTCCGTTTTGTCAA; Bifi forward (5’-3’) TCTGGCTCAGGATGAACGC, reverse (5’-3’) CACCGTTACACCGGGAATTC; Lacto forward (5’-3’) TGGAAACAGRTGCTAATACCG, reverse (5’-3’) GTCCATTGTGGAAGATTCCC. Cycling conditions were 95˚C for 40 s; 40 cycles of 95˚C for 5 s, 60˚C for 30 s; 95˚C for 15 s; and 60˚C for 1 h.
Clinical index assay
The level of alanine transaminase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), albumin, smooth muscle antibody (ANA/SMA), IgG, IgA, and IgM in serum were determined using the corresponding implements according to the manufacturers’ instruction (Beckman Coulter).
Enzyme-linked immunosorbent assay (ELISA) assay
The endotoxin (ET), diamine oxidase (DAO), TGF-β, IL-10, IL-6, and TNF-α ELISA kits were obtained from DECO. The KGF-1 and KGF-1 ELISA kits were obtained from Abcam. The IL-21 ELISA kits were obtained from Multisciences. The levels of ET, DAO, TGF-β, KGF-2, KGF-1, IL-10, IL-6, IL-21, and TNF-α were measured according to the protocol of ELISA assay kits.
Hematoxylin-eosin (HE) staining
Liver and colon tissues were collected from the EAH model for HE staining. HE staining was performed according to the previous report [18].
Flow cytometric analysis
Peripheral blood mononuclear cells (PBMCs) from AIH patients and EAH mice were isolated by density gradient centrifugation according to the manufacturer’s instruction. The TFH cells in PBMC were stained with BV510-anti-CD4 (0.2 mg/mL), PerCP-Cy5.5-anti-CXCR5 (0.1 mg/mL), and PE-anti-FoxP3 (0.1 mg/mL) as previously described [8, 18].
RT-qPCR assay
Total RNA from peripheral blood mononuclear cells (PBMCs) or tissue was extracted using TRIzol reagent (TaKaRa) according to the manufacturers’ instructions. A cDNA Reverse Transcription Kit (TaKaRa) and an SYBR PrimeScript RT-qPCR Kit (Takara) were used for mRNA expression assessment according to the manufacturer’s instructions. The primers’ sequences were listed in Table 1. GAPDH served as an internal reference.
Western Blot assay
Total protein from PBMCs was extracted using RIPA lysis buffer containing phosphatase and protease inhibitors (Beyotime Biotech). Total protein (30 µg) from each sample was separated on a 10% SDS PAGE gel as previously described [19]. The antibodies included anti-TLR4 (CST), anti-MyD88 (CST), anti-p65 (Abcam), anti-p-p65 (Abcam) and anti-ACTB (CST).
Statistical analysis
The student’s t-test was used to assess statistical significance among different experimental groups. Data are expressed as the mean ± SEM. *P < 0.05 and **P < 0.01 levels were considered significant.